ID: 910287746

View in Genome Browser
Species Human (GRCh38)
Location 1:85574364-85574386
Sequence TGCGAATGGCCTTGCTGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910287746_910287751 16 Left 910287746 1:85574364-85574386 CCATGACAGCAAGGCCATTCGCA 0: 1
1: 0
2: 0
3: 12
4: 101
Right 910287751 1:85574403-85574425 ATCTCTTGCCAGTTTTCAGAAGG No data
910287746_910287753 26 Left 910287746 1:85574364-85574386 CCATGACAGCAAGGCCATTCGCA 0: 1
1: 0
2: 0
3: 12
4: 101
Right 910287753 1:85574413-85574435 AGTTTTCAGAAGGAATCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910287746 Original CRISPR TGCGAATGGCCTTGCTGTCA TGG (reversed) Intronic
900278391 1:1848482-1848504 TGGGATTGGTCTTGCTGTCTTGG - Intronic
910287746 1:85574364-85574386 TGCGAATGGCCTTGCTGTCATGG - Intronic
919964382 1:202507171-202507193 TGTAAGTGGCATTGCTGTCAGGG - Intronic
920424997 1:205868031-205868053 TGACAATGGCCCTGCTTTCAAGG - Intergenic
921279814 1:213555285-213555307 TGCCAAGGGCCTTGCTGCCAGGG - Intergenic
1064947437 10:20806530-20806552 TGCATCTGGCCTTGATGTCAGGG - Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1065463748 10:25997326-25997348 TTCGAATGGCCTTCCTTTCTAGG + Intronic
1075973342 10:126673451-126673473 TGGGAAAGGCCTTCCTGTCTGGG + Intergenic
1078781549 11:14443649-14443671 TGCTAAGGGCCTAGCTGCCATGG + Intronic
1080712951 11:34769178-34769200 TGTTAATGTCCTTGGTGTCAAGG + Intergenic
1083511625 11:63214019-63214041 TGATAATGGCTTAGCTGTCATGG + Intronic
1092099169 12:5869151-5869173 TGCGAATGGCCCTGCTGGATGGG - Intronic
1092551499 12:9506845-9506867 TGCTTATGGCCTGGGTGTCATGG - Intergenic
1093674735 12:21925379-21925401 TGCGAAAGGCCGTGATGTAATGG + Intronic
1096351627 12:50905600-50905622 TGACAATGGCCCTGCTTTCAAGG - Intergenic
1098326964 12:69312906-69312928 TGTTAATGTCCTTGCTGTCAAGG - Intergenic
1098427410 12:70380465-70380487 TGCCAATGGACTTGTTCTCAGGG + Intronic
1098560257 12:71864967-71864989 TGGTAATGTCCTTGCTGTCAAGG + Intronic
1105405850 13:20132016-20132038 TGGGGATGGCCTTGCTGACAAGG + Intergenic
1105708658 13:22984281-22984303 TGTGAATGGTCGTGCAGTCAGGG - Intergenic
1108449850 13:50550136-50550158 TGGGACTGGCCTTGCTCACAGGG - Intronic
1110445948 13:75580917-75580939 TGTGAATAGCCTTGCTTTTAAGG - Intronic
1116447009 14:45022159-45022181 TGACAATGGCCCTGCTTTCAAGG - Intronic
1118327670 14:64792545-64792567 TGAGAGTGGCCTTGCAGACAGGG + Intronic
1122088267 14:99321764-99321786 AGGGAATGTCCTTGCTCTCAAGG - Intergenic
1122214523 14:100194045-100194067 TGCCATTGGCCCTGATGTCAGGG - Intergenic
1123208075 14:106732993-106733015 TGTGAATGGACGTGCAGTCAGGG + Intergenic
1124632128 15:31344033-31344055 CACAAATGGCCTGGCTGTCAGGG + Intronic
1128318214 15:66674689-66674711 TGTGAAGGGCCTGGATGTCAAGG - Intronic
1128954894 15:71929912-71929934 TTCGTATGGCTTTGCTATCAGGG + Intronic
1131153005 15:90058600-90058622 TGTGGGTGGCCTGGCTGTCAGGG + Intronic
1132993508 16:2810549-2810571 TGTTAATGTCCTTGATGTCAAGG + Intergenic
1135938380 16:26800067-26800089 TAAGAATGGCCTTTCTTTCAAGG + Intergenic
1139469694 16:67171493-67171515 TGGGAAGGGCCTGGCTGTCCAGG + Intronic
1141734445 16:85842966-85842988 TGCGCAGGGCCATGCTGTCTTGG + Intergenic
1144711210 17:17402754-17402776 TGGGAATGGAGTTCCTGTCAGGG + Intergenic
1146997507 17:37333985-37334007 TGACAATGGCCCTGCTTTCAAGG + Intronic
1148065061 17:44862977-44862999 AGCTCATGTCCTTGCTGTCAAGG - Intronic
1154479861 18:14809640-14809662 TGTGAATGGACGTGCAGTCAGGG - Intronic
1154945450 18:21157683-21157705 AGGGAATGGCATTGCTGTCAAGG + Intergenic
1155226874 18:23736985-23737007 TGGGATTGTCCTTGCTGGCATGG + Intronic
1161996547 19:7716115-7716137 TGAGACTAGCCTTGCTGACATGG + Intergenic
1165711156 19:38011937-38011959 TGCTGATGGCCTTGCTGTGGAGG + Intronic
1167300119 19:48673160-48673182 TGCGGGTGGCCTGGCTGGCAGGG - Intergenic
1168271448 19:55251993-55252015 TGGGACTGGCTTTGCTGGCATGG - Intronic
1168416751 19:56174252-56174274 TGTGAATGGCTTTGCTGGGAAGG - Intergenic
926053809 2:9761944-9761966 TGCAAATGGCCTTGCTGAGCTGG - Intergenic
927176139 2:20410267-20410289 TGTGAATGTCCTTGGTGTCAAGG + Intergenic
927652843 2:24922716-24922738 TGGGCATGGCCTTGCGGACAGGG - Intergenic
928178628 2:29052045-29052067 TGCCAGTTGTCTTGCTGTCAGGG - Exonic
931866778 2:66421366-66421388 TGGGAATGGCTTTGGTGTCTAGG + Intergenic
932053911 2:68425696-68425718 TGGGAATGGCCTCGGTGCCAGGG + Intergenic
937590257 2:123604974-123604996 CGCTAATGGCCTTGCTTTAATGG + Intergenic
940660677 2:156541414-156541436 TCAGAATGGCCTAGCTGTCCTGG - Intronic
945103663 2:206288407-206288429 TGTGAATGTCCTTGATGTCAAGG + Intronic
945366180 2:208957043-208957065 TGCTCATGGCTTTGCTGTCATGG - Intergenic
946037423 2:216755132-216755154 TCCGACTGTCCTTGCTTTCAGGG + Intergenic
1172165038 20:32893753-32893775 TGGGCATGGCCTGGCTGGCATGG + Intronic
1175564666 20:59963666-59963688 TGAGAATGTCCCTGCTGTCCTGG - Intronic
1182621678 22:31621844-31621866 TGCCAACGCGCTTGCTGTCACGG - Exonic
1184127552 22:42498993-42499015 TATGAATGGACTTGCAGTCAGGG - Intergenic
952402064 3:32972366-32972388 TGATAATGGCCGAGCTGTCATGG + Intergenic
956888017 3:73579966-73579988 TGTGAAAGGCCTTCCTTTCATGG - Intronic
962904296 3:139788234-139788256 AACGAAAGTCCTTGCTGTCAGGG - Intergenic
963989444 3:151636113-151636135 GGCCCATTGCCTTGCTGTCAAGG + Intergenic
971334306 4:25708549-25708571 TGCAAATGGCCCTGCTGTCTAGG - Intergenic
972179049 4:36442044-36442066 TGACAATGGCCCTGCTTTCAAGG - Intergenic
976213033 4:82691319-82691341 TAAGAATGGCCTTGCTGGCCAGG - Intronic
978289700 4:107123155-107123177 TGCTAGTGGCATTGCTGTCCTGG + Intronic
978586341 4:110279583-110279605 TGACAATGGCCCTGCTTTCAAGG - Intergenic
983926701 4:173410374-173410396 TAGGAATGGCCTTGCTGCTATGG - Intergenic
984902093 4:184594546-184594568 AGGGAATGGTCTTGCTGTCTCGG + Intergenic
985092524 4:186378779-186378801 TGCGAATGGCCTTGTTTTATTGG - Intergenic
987245189 5:16041605-16041627 TGGGTGTGTCCTTGCTGTCAGGG + Intergenic
987994655 5:25261218-25261240 AGGGATTGGTCTTGCTGTCAGGG - Intergenic
994216732 5:97145690-97145712 TGTCAATGTCCTTGCTGTCCAGG + Intronic
998365194 5:141625967-141625989 TGAGAATGGCCTTCCTGTTATGG + Intronic
1002885680 6:1291945-1291967 TGTTATTGGCCTGGCTGTCAAGG - Intergenic
1005416610 6:25606496-25606518 TGAGACTGTCCTTGCTTTCAGGG + Intronic
1005650164 6:27878703-27878725 TGGGAATGGCATTGCTGTGGGGG + Intergenic
1005758211 6:28944305-28944327 TGCGAAAGGCCTTCCTGTACGGG - Exonic
1006440497 6:34050823-34050845 TGCGAGTGGCCTTGCAGACAAGG - Intronic
1006719616 6:36141877-36141899 ACAGAATGGCCCTGCTGTCAAGG + Intronic
1010183139 6:73111642-73111664 TTTGCATGGCCTTGCTGACATGG - Intronic
1012404130 6:98875352-98875374 TGAGATTGGCTTTTCTGTCAAGG + Intronic
1013499338 6:110732293-110732315 TGAGACTAGCCTGGCTGTCACGG + Intronic
1014061081 6:117072767-117072789 TGCTCATGGCCTTCCTGCCAGGG + Intergenic
1015617989 6:135099611-135099633 AGGGAATAGCCTTTCTGTCATGG - Intronic
1016809571 6:148246937-148246959 TGCAGATGGCCCTGCTCTCAAGG + Intergenic
1019724459 7:2593456-2593478 CGCGAATGGCATTACTGTGAGGG - Intronic
1022603918 7:31789916-31789938 TGCTAATGACCTGGCTTTCAAGG - Intronic
1024980776 7:55155925-55155947 TGCGAAGGGCCTTGCCGCAAAGG + Exonic
1025190581 7:56892793-56892815 TGTGAATGGCAGGGCTGTCATGG + Intergenic
1025681371 7:63684183-63684205 TGTGAATGGCAGGGCTGTCATGG - Intergenic
1025735678 7:64144655-64144677 TGTGAATGGACATGCAGTCAGGG - Intronic
1028327566 7:89545815-89545837 TGTGAATGGACGTGCAGTCAGGG - Intergenic
1030461225 7:109839303-109839325 TGGGAATGGCATTGCTGTAGGGG - Intergenic
1031471767 7:122175605-122175627 TGACAATGGCCCTGCTTTCAAGG + Intergenic
1032726067 7:134591055-134591077 TGACAATGGCCCTGCTTTCAAGG + Intergenic
1039365529 8:36924416-36924438 GCCGAATGGCATTGATGTCAGGG - Intronic
1041663409 8:60420668-60420690 TGACAAAGGCCTTGCTTTCAAGG - Intergenic
1043750692 8:83929868-83929890 TGGGAATGGGGTGGCTGTCAGGG - Intergenic
1044502444 8:92974170-92974192 TGGGTATGTCCTTGCTGTCAGGG - Intronic
1047940209 8:129822095-129822117 TGCTCTTGGTCTTGCTGTCATGG - Intergenic
1048062787 8:130937672-130937694 TGCAAATGTCCTTGCTGGAAAGG - Intronic
1050473050 9:6012787-6012809 TGCTTATGGCCTGGGTGTCATGG - Exonic
1054375493 9:64446379-64446401 TGCAACAGCCCTTGCTGTCACGG + Intergenic
1191217376 X:57947412-57947434 TGAAAATGGCCATGCTGCCAAGG - Intergenic
1196862475 X:120041071-120041093 TGTGAATGGAGTTGCAGTCAAGG - Intergenic
1196880627 X:120195273-120195295 TGTGAATGGAGTTGCAGTCAAGG + Intergenic
1197501378 X:127245728-127245750 TGAGAATTCACTTGCTGTCATGG - Intergenic
1202300018 Y:23403038-23403060 TGTAAGTGGCATTGCTGTCAGGG - Intergenic
1202570792 Y:26267560-26267582 TGTAAGTGGCATTGCTGTCAGGG + Intergenic