ID: 910289925

View in Genome Browser
Species Human (GRCh38)
Location 1:85589611-85589633
Sequence CCCCAACCCCAAGAATGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910289925_910289927 -2 Left 910289925 1:85589611-85589633 CCACAGCATTCTTGGGGTTGGGG No data
Right 910289927 1:85589632-85589654 GGTGCCCCCTAATACAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910289925 Original CRISPR CCCCAACCCCAAGAATGCTG TGG (reversed) Intergenic
No off target data available for this crispr