ID: 910289927

View in Genome Browser
Species Human (GRCh38)
Location 1:85589632-85589654
Sequence GGTGCCCCCTAATACAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910289918_910289927 18 Left 910289918 1:85589591-85589613 CCTCTATGAGCCTGCAAGAACCA No data
Right 910289927 1:85589632-85589654 GGTGCCCCCTAATACAGATATGG No data
910289919_910289927 8 Left 910289919 1:85589601-85589623 CCTGCAAGAACCACAGCATTCTT No data
Right 910289927 1:85589632-85589654 GGTGCCCCCTAATACAGATATGG No data
910289925_910289927 -2 Left 910289925 1:85589611-85589633 CCACAGCATTCTTGGGGTTGGGG No data
Right 910289927 1:85589632-85589654 GGTGCCCCCTAATACAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910289927 Original CRISPR GGTGCCCCCTAATACAGATA TGG Intergenic
No off target data available for this crispr