ID: 910290584

View in Genome Browser
Species Human (GRCh38)
Location 1:85596660-85596682
Sequence CTGGAATTGTAGAAGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910290584_910290587 -6 Left 910290584 1:85596660-85596682 CCCGCTTCCTTCTACAATTCCAG No data
Right 910290587 1:85596677-85596699 TTCCAGTCTGTGTATTTTTGTGG No data
910290584_910290590 -4 Left 910290584 1:85596660-85596682 CCCGCTTCCTTCTACAATTCCAG No data
Right 910290590 1:85596679-85596701 CCAGTCTGTGTATTTTTGTGGGG No data
910290584_910290588 -5 Left 910290584 1:85596660-85596682 CCCGCTTCCTTCTACAATTCCAG No data
Right 910290588 1:85596678-85596700 TCCAGTCTGTGTATTTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910290584 Original CRISPR CTGGAATTGTAGAAGGAAGC GGG (reversed) Intergenic
No off target data available for this crispr