ID: 910292475

View in Genome Browser
Species Human (GRCh38)
Location 1:85612785-85612807
Sequence TATCCAGGAGTAGCCTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910292475_910292477 29 Left 910292475 1:85612785-85612807 CCTGTGGAGGCTACTCCTGGATA No data
Right 910292477 1:85612837-85612859 AATTATATCACATTCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910292475 Original CRISPR TATCCAGGAGTAGCCTCCAC AGG (reversed) Intergenic
No off target data available for this crispr