ID: 910303077

View in Genome Browser
Species Human (GRCh38)
Location 1:85729394-85729416
Sequence TGGCTGAGCCTATTTTAAAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910303077 Original CRISPR TGGCTGAGCCTATTTTAAAT GGG Exonic
905096010 1:35471506-35471528 TCACTGGGCCTGTTTTAAATGGG - Intronic
908382494 1:63609851-63609873 TGGCCTAGCCTACCTTAAATGGG - Intronic
908535619 1:65074104-65074126 TGGCTGGGCCATTTTTAAAAAGG + Intergenic
908568912 1:65388174-65388196 AAGCTGAGCCTATTCTAACTGGG + Intronic
909377670 1:74958636-74958658 TGGCAGAGCCTAATTAAATTAGG + Intergenic
909681806 1:78300143-78300165 CGGCTGACCCCATTTTACATGGG + Intergenic
910303077 1:85729394-85729416 TGGCTGAGCCTATTTTAAATGGG + Exonic
911095465 1:94051345-94051367 TGGCTTGGCCTTTTTTAAATAGG + Intronic
913090224 1:115471723-115471745 TGCCTGAGCCTATTTTAAAAGGG - Intergenic
913663485 1:121026294-121026316 TGTGTGTGGCTATTTTAAATGGG - Intergenic
914014877 1:143809563-143809585 TGTGTGTGGCTATTTTAAATGGG - Intergenic
914162945 1:145151644-145151666 TGTGTGTGGCTATTTTAAATGGG + Intergenic
914653497 1:149718119-149718141 TGTGTGTGGCTATTTTAAATGGG - Intergenic
918101244 1:181376746-181376768 TGGCTGAGTCTATATTTGATGGG + Intergenic
918514317 1:185345490-185345512 TGGGGGATGCTATTTTAAATAGG - Intergenic
919904721 1:202070354-202070376 TGGCTGAGCATCTGTTAACTGGG - Intergenic
922596320 1:226816205-226816227 TAGCTGAGGCTGTTTTGAATTGG - Intergenic
923552665 1:234976575-234976597 ATACTGAGCCTGTTTTAAATGGG + Intergenic
1064155385 10:12899057-12899079 TGGCTCAGCCTTTGTTAATTAGG - Intronic
1066753705 10:38687374-38687396 TCACTTAGCCTATGTTAAATTGG - Intergenic
1072039635 10:91594598-91594620 TGGCTGAGCCTGTGGTCAATAGG + Intergenic
1075025980 10:118983386-118983408 TGGAGGAGACTATTTTAAATAGG + Intergenic
1079684298 11:23337705-23337727 TGGCTGAGCTGGTTTTAAGTTGG - Intergenic
1079850352 11:25525599-25525621 TGGCTTAGCTTATTTTCAGTAGG - Intergenic
1081018910 11:37918396-37918418 GGAGTGAGGCTATTTTAAATAGG - Intergenic
1081466790 11:43326901-43326923 TGACAGAGCCAATTTTAAACTGG + Intronic
1083068334 11:59948954-59948976 TGGCAGTTCCTATTTTAAAAAGG - Intergenic
1083363258 11:62125925-62125947 TGGCTGGGGCTACTTTAGATTGG + Intronic
1085914101 11:80863783-80863805 TGTCTTAGCCTATGTAAAATGGG - Intergenic
1086523107 11:87694267-87694289 TTGGTGTGTCTATTTTAAATGGG + Intergenic
1087669329 11:101086824-101086846 TGTGTGTGGCTATTTTAAATGGG - Intronic
1088215254 11:107500486-107500508 TAGGTGAGCATTTTTTAAATAGG + Intergenic
1088964073 11:114700331-114700353 TGGTTGATGCTATTTTAAAACGG + Intronic
1091694605 12:2619409-2619431 TGTCTGTGACCATTTTAAATGGG + Intronic
1092824749 12:12388387-12388409 TGGCTGCTCCTAATTTAGATGGG + Intronic
1095564629 12:43608027-43608049 TAGCTGTAGCTATTTTAAATTGG + Intergenic
1096559746 12:52427231-52427253 GGGCTGAGCTTATTGTATATAGG + Intronic
1097156753 12:57017602-57017624 GTGCTTAGCCTATTTTTAATGGG - Intronic
1100272674 12:93041346-93041368 TGGAGGAGACTATTTTAGATAGG - Intergenic
1100652541 12:96606149-96606171 GAGCTGAGCCTATTTTAGACGGG + Intronic
1106022447 13:25928431-25928453 TGGCTGAGCTAATTTTAGAGAGG - Intronic
1107152063 13:37123267-37123289 TGTGTGTGACTATTTTAAATGGG + Intergenic
1109769609 13:66953813-66953835 TGGGTGAGCTTACATTAAATAGG + Intronic
1111268293 13:85849121-85849143 TCACTGAGCATATTTTAAGTAGG + Intergenic
1111602119 13:90487863-90487885 AGGCTGACCCAATTTTAAGTAGG + Intergenic
1112614833 13:100993365-100993387 TGTCTGTGGCTATTATAAATGGG - Intergenic
1116733551 14:48658076-48658098 TCACTGAACATATTTTAAATAGG - Intergenic
1117646119 14:57854779-57854801 TGGCATAGCTTATTTAAAATGGG - Intronic
1118755783 14:68842952-68842974 TGGCTGAGCCTATATGACCTTGG - Intergenic
1120384326 14:83825025-83825047 TGTCTGAGCCTTTACTAAATAGG - Intergenic
1120669207 14:87344728-87344750 TGGCTTCCCCAATTTTAAATTGG - Intergenic
1120979621 14:90278591-90278613 TGGCTGAGACTTTCTTAACTCGG + Intronic
1121386528 14:93532154-93532176 TGGCTGCCCTTATTTTAAATGGG + Intronic
1121686488 14:95839128-95839150 TGGCTAAGATTATTTTAATTTGG + Intergenic
1123984182 15:25630378-25630400 TGGCTGGTCCTAATTCAAATAGG - Intergenic
1125736431 15:41929553-41929575 GGGCTCAGCCTTCTTTAAATGGG - Intronic
1126329080 15:47512610-47512632 TGGCTGAGACTATTCTTAAAAGG + Intronic
1126556326 15:49992013-49992035 TGGCAAAGCCTATTTTACAAAGG - Intronic
1127377795 15:58401257-58401279 TTCCTGAGTCTATTCTAAATTGG + Intronic
1127430418 15:58901931-58901953 TGGCAAAGCCAATTTTAAAATGG + Intronic
1134377572 16:13692028-13692050 TGTCTGTGGCTATTGTAAATAGG - Intergenic
1139505384 16:67395835-67395857 TGGCTGAGCCTCTCTAAACTGGG - Intronic
1141051326 16:80767318-80767340 TCTCTGAGCCTATTTTACTTTGG + Intronic
1141375727 16:83528284-83528306 TGGTTGATCACATTTTAAATGGG + Intronic
1144083558 17:11786282-11786304 TCTCTGAGCCTCTGTTAAATTGG - Intronic
1147457061 17:40544454-40544476 AGGCTGGGACAATTTTAAATAGG + Intergenic
1148726248 17:49792755-49792777 TAGCCTAGCCTACTTTAAATAGG - Intronic
1153473106 18:5468472-5468494 TGGCTGAGTCTAGTTTTTATGGG - Intronic
1153689921 18:7581993-7582015 TGGCTAAGCAAATTTTACATAGG + Intronic
1155049788 18:22136703-22136725 TGGCTATGCTTCTTTTAAATAGG - Intergenic
1155933437 18:31729854-31729876 AGGAGGAGGCTATTTTAAATTGG - Intergenic
1156086399 18:33410132-33410154 TGACAAAGCCTATTCTAAATTGG - Intronic
1158302747 18:56070460-56070482 AGGCTGAGCATATTATAATTAGG - Intergenic
1164272857 19:23688603-23688625 TGCCTGAGCCTTTTTTACAGAGG + Intergenic
926486083 2:13460119-13460141 TATCTGAGCCTTATTTAAATTGG + Intergenic
930898009 2:56468500-56468522 TGTCTGTGGCTATTGTAAATGGG - Intergenic
934941370 2:98505185-98505207 TGCCTGAACCTTTTCTAAATGGG - Intronic
935134502 2:100288074-100288096 TGTATGCGCTTATTTTAAATGGG - Intronic
935442064 2:103110578-103110600 TAGCTGAGCCTAGATTTAATGGG + Intergenic
935654389 2:105409397-105409419 TGGCTGTGGCTATTCTAAGTAGG + Intronic
935831708 2:107007367-107007389 TGGATAAGATTATTTTAAATTGG + Intergenic
938930325 2:136081217-136081239 TTGCTTAGGCTATTTTGAATCGG - Intergenic
939229088 2:139403630-139403652 TTGCTCAGCCTATTGAAAATGGG - Intergenic
939885733 2:147679701-147679723 AGGCTGAGCCAATTTTAGAGTGG - Intergenic
941210912 2:162637984-162638006 TGGAGGAGCATTTTTTAAATAGG + Intronic
942196614 2:173527228-173527250 TGGCTAGGACTATGTTAAATAGG + Intergenic
942866064 2:180676368-180676390 TAGCTGAGCCCATTAAAAATGGG - Intergenic
943058652 2:183014589-183014611 TGGCCAAGAATATTTTAAATAGG - Intronic
944272442 2:197798379-197798401 TGGCTGAGCCCACTGTAAATGGG + Intergenic
948224919 2:236301287-236301309 TGGCTGAAACTATATTAATTTGG + Intergenic
1170065034 20:12301834-12301856 TGGCTAAGTCTATTTGTAATTGG - Intergenic
1173008848 20:39162782-39162804 TTGCTGATACTATTGTAAATGGG - Intergenic
1174980314 20:55387099-55387121 TGGGTGAGAGTTTTTTAAATAGG + Intergenic
1181153855 22:20904661-20904683 TGGCTCAAACTATTTTGAATAGG + Intergenic
1184662316 22:45971089-45971111 TGGCTGCGTCTTTATTAAATGGG + Intronic
949681165 3:6515995-6516017 TTGCTGAGCCAGTTTTCAATAGG + Intergenic
951809075 3:26679593-26679615 TGGATGGTGCTATTTTAAATAGG - Intronic
954628663 3:52036439-52036461 TCTCTGAGCCTCATTTAAATGGG - Intergenic
956850717 3:73225784-73225806 TGGCAGAACATATTTCAAATGGG + Intergenic
957757796 3:84512768-84512790 TGTGTGTGCCTATTGTAAATGGG + Intergenic
959115753 3:102176032-102176054 TTGCAGAGCCTATTTTAAGGAGG + Intronic
959789284 3:110338011-110338033 TGTGTGTGTCTATTTTAAATGGG + Intergenic
960834069 3:121885752-121885774 TGGCAGGTGCTATTTTAAATAGG - Intronic
960984589 3:123267502-123267524 TATCTGAGCCAATTATAAATAGG - Intronic
965010070 3:163076494-163076516 TATCTGAGGCTATTGTAAATGGG - Intergenic
966051933 3:175628278-175628300 TGTCTGAGCATATTTAAGATAGG + Intronic
967619136 3:191610864-191610886 TGTATGTGGCTATTTTAAATGGG + Intergenic
971007516 4:22391677-22391699 TGGCTGCCCACATTTTAAATAGG + Intronic
973893349 4:55389495-55389517 TGGAAGAGTCTATTTTAGATGGG + Intergenic
975258714 4:72271020-72271042 TGGATGAGAATAATTTAAATTGG + Intergenic
977277609 4:94997373-94997395 TGGCTTATCCTATTTTAGAATGG - Intronic
980524275 4:133969329-133969351 TGGCTGAGTCTATTTTAAATGGG - Intergenic
982908466 4:161108755-161108777 CAGCTGACCCTATTTTAAACAGG + Intergenic
989509652 5:42270566-42270588 TAGCTAAGGCTATTATAAATTGG - Intergenic
994328410 5:98476798-98476820 TGGCTGAGCCTATTTGTCAGAGG + Intergenic
995028615 5:107453439-107453461 ATGCTGAGCCTATTATATATGGG + Intronic
995063488 5:107836362-107836384 TGGCTGTGCCTAATTTCAACGGG - Intergenic
995085626 5:108105995-108106017 GGGTTAATCCTATTTTAAATAGG + Intronic
995750742 5:115451011-115451033 AGGCTGAGTCTATAGTAAATGGG - Intergenic
997363424 5:133310030-133310052 TGGTTCAGCGAATTTTAAATAGG - Intronic
1000612732 5:163392669-163392691 TGTCTGTGGCTATTGTAAATGGG - Intergenic
1000670425 5:164055826-164055848 TGGCTGTGTTTATTATAAATGGG - Intergenic
1004309959 6:14536524-14536546 TGGCTGAGCCCATAGTCAATGGG - Intergenic
1007457019 6:41986524-41986546 TTGCTGATGCTATTATAAATGGG + Intronic
1011401869 6:86971628-86971650 TGTCTGAGCATATGTTAACTGGG + Intronic
1017385768 6:153880895-153880917 TGGCATAGCCTATTTCAAATGGG - Intergenic
1017466647 6:154700176-154700198 TGGCTGAGAGTAATTTTAATAGG + Intergenic
1022134487 7:27434630-27434652 TTGCTGTGCCTATGTTAAAGAGG + Intergenic
1022589164 7:31644590-31644612 TTGCTGAGCCTATTTAAAGGTGG + Intronic
1028845994 7:95480651-95480673 TGACTGAGCCACTTTTAAAGGGG + Intronic
1030371384 7:108703373-108703395 TGGCTCAGTATATTTTTAATAGG - Intergenic
1030833996 7:114260741-114260763 TGTCTGAACTCATTTTAAATTGG - Intronic
1033476632 7:141699180-141699202 TGGGTGGGCCAATATTAAATAGG + Intronic
1034383107 7:150716280-150716302 TCTCTGGGCCTATTTTATATGGG + Intergenic
1043675073 8:82940928-82940950 TGGCCAAGACTATGTTAAATAGG - Intergenic
1045396887 8:101769848-101769870 TGGCTCAGCCTTTGTTAATTAGG - Intronic
1046159999 8:110349426-110349448 AGAGTGAGGCTATTTTAAATTGG - Intergenic
1046565597 8:115895701-115895723 TGACTGAGCTTTATTTAAATAGG + Intergenic
1046687897 8:117247489-117247511 TGTCTTAGACCATTTTAAATGGG - Intergenic
1047497364 8:125418075-125418097 TGGCTGAGAGTATTTTTAAATGG + Intergenic
1048282029 8:133112719-133112741 GGGCTGGGGCTATTTTATATAGG - Intronic
1048392680 8:133982906-133982928 TTGCTGAACCTATCTTGAATGGG + Intergenic
1051122272 9:13764273-13764295 TGGCTGAAACTATTTTAGGTGGG + Intergenic
1055306245 9:74932147-74932169 TGCCTGTGGCTATTTTAAATGGG - Intergenic
1055832598 9:80399762-80399784 TGGCTGAGATTATTTGCAATAGG - Intergenic
1057552859 9:96064871-96064893 TGGCTGAAGCTAGTTTGAATGGG - Intergenic
1185941677 X:4327639-4327661 TGGTTGTGCCTATTACAAATAGG - Intergenic
1187213261 X:17250331-17250353 TGGTTCAGCCTACATTAAATAGG + Intergenic
1187573015 X:20524275-20524297 TGACTGAACATATTTTAAAAAGG + Intergenic
1189453324 X:41160090-41160112 TGGCTGAGACTAACATAAATTGG - Intronic
1189657375 X:43259591-43259613 TGTGTGTGCCTATTGTAAATGGG + Intergenic
1190255410 X:48758731-48758753 TGGCTCTGCCCATTGTAAATGGG + Intergenic
1192742723 X:73909056-73909078 TGTGTGTGCCTATTGTAAATGGG + Intergenic
1193683366 X:84549053-84549075 TATCTGTGGCTATTTTAAATGGG + Intergenic
1193723035 X:85008999-85009021 TTTCTGATGCTATTTTAAATGGG + Intronic
1194460166 X:94156757-94156779 TGTTTGAGGCTATTTTAAGTGGG + Intergenic
1194862027 X:99011233-99011255 TTGCTGAAGCTATTTAAAATTGG - Intergenic
1195596928 X:106702465-106702487 TGCCTGAGCCTATATAAAGTAGG + Intronic
1196419137 X:115505122-115505144 TGGCTGAGTTTATTTTTAAAGGG + Intergenic
1197372642 X:125643647-125643669 TTGCTTAGACTATTTTGAATTGG + Intergenic
1200761051 Y:7039450-7039472 TGCCTGAACCTCTTTTATATGGG + Intronic