ID: 910310818

View in Genome Browser
Species Human (GRCh38)
Location 1:85822614-85822636
Sequence GTAGTTTGACTATGTAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910310818_910310821 17 Left 910310818 1:85822614-85822636 CCTGTGTTACATAGTCAAACTAC 0: 1
1: 0
2: 1
3: 5
4: 128
Right 910310821 1:85822654-85822676 TATGACAATGATTCTTTGCTTGG 0: 1
1: 1
2: 15
3: 71
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910310818 Original CRISPR GTAGTTTGACTATGTAACAC AGG (reversed) Intronic
901040847 1:6362403-6362425 GGAGTTTCACTCTGTCACACAGG - Intronic
902897927 1:19492061-19492083 GGAGTTTCACTATGTCACCCCGG - Intergenic
906169875 1:43715596-43715618 GTAGTCTCACTATGTTACCCAGG - Intronic
906399386 1:45493762-45493784 GGAGTTTCACTCTGTAACCCAGG - Intergenic
907462127 1:54611372-54611394 GTAGTCTGACTCTGTCACCCAGG - Intronic
908076482 1:60525140-60525162 GAAGTTTCACTATGTTACCCAGG + Intergenic
908933609 1:69346440-69346462 CTAGTTTGAATCTGCAACACTGG + Intergenic
909026758 1:70489996-70490018 GAAGTTTCACTATGTTACCCAGG + Intergenic
909424709 1:75509714-75509736 GTATTTTGTCTCTGTAACACAGG - Intronic
909780996 1:79547249-79547271 GTAGTTAGACTATGGTACTCAGG + Intergenic
910310818 1:85822614-85822636 GTAGTTTGACTATGTAACACAGG - Intronic
911354426 1:96798378-96798400 GGAGTTTCACTCTGTCACACAGG - Intronic
911562755 1:99426412-99426434 GTATTTTCAATCTGTAACACAGG + Intergenic
915335675 1:155139862-155139884 TTAGTTTGAGTATGGAAAACGGG - Intergenic
917550279 1:176019667-176019689 GTATTTTCACTATGTTACCCAGG - Intronic
924474772 1:244373300-244373322 GTAGTTTCACTATGTTGCCCAGG - Intronic
1062816155 10:501951-501973 GGAGTTTCACTATGTTACCCAGG - Intronic
1063717783 10:8545722-8545744 GGAGTTTTACTATGTAGCCCAGG + Intergenic
1066379336 10:34888084-34888106 GGGGTTTTACTATGTAACCCAGG - Intergenic
1069538369 10:69273239-69273261 GGAGTCTCACTCTGTAACACAGG + Intronic
1072275916 10:93823149-93823171 GGAGTTTCACTATGTTGCACAGG - Intergenic
1079785564 11:24667207-24667229 GGAGTCTCACTATGTCACACAGG + Intronic
1086904932 11:92407524-92407546 GTAGTTTGCCTGTGTAACTTTGG + Intronic
1093232196 12:16559757-16559779 GGAGTTTCACTATGTTACCCAGG - Intronic
1094041954 12:26127495-26127517 GCAGTTTGAGTAGGTATCACGGG - Intronic
1097548640 12:61037673-61037695 AGAGTTTAACTTTGTAACACAGG - Intergenic
1102232374 12:111272488-111272510 GTAGTCTCACTCTGTCACACAGG + Intronic
1107126589 13:36853257-36853279 GGAGTTTCACTCTGTCACACAGG - Intronic
1110917196 13:81036000-81036022 GTGATTTTGCTATGTAACACTGG - Intergenic
1112481552 13:99780737-99780759 GTAGTCTCACTATGTTGCACAGG + Intronic
1116276067 14:42833501-42833523 GTTGTATGACTTTGTAAAACAGG + Intergenic
1116791817 14:49347679-49347701 GGAGTTTGACTCTGTCACCCAGG + Intergenic
1122726114 14:103753999-103754021 GCAGTTAGACTATGTTTCACTGG + Intronic
1127086556 15:55429194-55429216 GTAGTCTGGCTCTGTAACCCAGG - Intronic
1127840515 15:62827512-62827534 GTACTTTGACTATGTGACTGTGG - Intronic
1127916956 15:63462672-63462694 GCAGTTTCACTATGTTACCCAGG - Intergenic
1128956727 15:71954795-71954817 GGACTTGGACTATGTAACAGAGG + Intronic
1133308247 16:4825187-4825209 GTAGCTTTACTATGTGAGACTGG - Intronic
1135764025 16:25161683-25161705 GTATTTTTACAAAGTAACACAGG - Intronic
1136352417 16:29719630-29719652 GGAGTCTCACTATGTAACCCAGG + Intergenic
1139206139 16:65030752-65030774 GTAGTTTCACCATGTTGCACAGG + Intronic
1140569361 16:76085321-76085343 GGAGTTTCACTATGTTACCCAGG + Intergenic
1141162157 16:81636553-81636575 GAAGTTTCACTCTGTAACCCAGG - Intronic
1141369144 16:83471298-83471320 GTAGTTTTACTCTGTCACCCAGG + Intronic
1143831719 17:9657472-9657494 GGAGTTTCACTATGTCACCCAGG - Intronic
1149903075 17:60499480-60499502 TTAGTTTGACTATGTTGTACAGG - Intronic
1157043849 18:44072019-44072041 GGAGTTTCACTATGTCACCCAGG - Intergenic
1159520427 18:69512945-69512967 TTAGTGTGAATATGTATCACTGG + Intronic
1162336340 19:10062852-10062874 GGAGTTTCACTATGTCACTCAGG - Intergenic
1163204588 19:15793453-15793475 GGAGTTTCACTATGTTACTCAGG + Intergenic
1166836987 19:45673536-45673558 GGAGTTTCACTATGTTACCCAGG - Intronic
1167940763 19:52943965-52943987 GTAGTCTCACTATGTAACCCAGG - Intronic
931232696 2:60388010-60388032 GCAGTTTGATTATGGAACATGGG + Intergenic
933089104 2:78096838-78096860 TTAGTCTGACTATGTCACCCAGG - Intergenic
933797738 2:85934003-85934025 GTGGTTTCACCATGTAACCCAGG - Intergenic
934733131 2:96672041-96672063 GTGGTTTCACTATGTTACCCAGG - Intergenic
935869400 2:107428674-107428696 GGAGTTTCACTATGTCACCCAGG - Intergenic
936379539 2:111972220-111972242 GTAGTTTCACCATGTCACCCAGG + Intronic
937749076 2:125452843-125452865 ATAGTTTGACTATGCAAGGCTGG - Intergenic
939188433 2:138887592-138887614 GTAGTTTCACTCTGTCACCCAGG + Intergenic
939538747 2:143466075-143466097 GTAGTTTGCCTTTGTCACATTGG + Intronic
941029745 2:160497288-160497310 GTAGTTTGTCTATTTAAATCAGG + Intergenic
1169275851 20:4233267-4233289 GGAGTTTTACTATGTTACCCAGG - Intronic
1169897408 20:10518759-10518781 GGGGTTTGGCTATGTAACTCAGG + Intronic
1169978019 20:11352738-11352760 GGAGTTGGCCTATGTAACCCAGG + Intergenic
1172532922 20:35646049-35646071 GTAGTTTCACTATGTGGCTCAGG - Intronic
1173909325 20:46652412-46652434 GTAGTCTCACTCTGTAACCCAGG + Intronic
954084150 3:48230859-48230881 GGAGTTTCACTATGTAAGCCAGG + Intergenic
955346625 3:58166396-58166418 GGAGTTTTACTATGTCACCCAGG - Intronic
955641825 3:61093908-61093930 GAAGTTTGACTCTGCTACACTGG + Intronic
958739959 3:98057083-98057105 GTAGTTTGGCTAAGTAAAATTGG - Intergenic
963795196 3:149624723-149624745 GGAGTTTGACTCTGTCACCCAGG + Intronic
964095680 3:152928589-152928611 GTAGTTTTACTATATAAAACGGG + Intergenic
969361810 4:6669164-6669186 GTGGTTTCACTATGTTACCCAGG - Intergenic
974456191 4:62131449-62131471 GTAGTTAGAGTCTGTGACACTGG - Intergenic
974804985 4:66867333-66867355 GCAGCATGACTATGTAACATAGG + Intergenic
975680926 4:76875252-76875274 GGAGTTTTACTATGTCACCCAGG + Intergenic
975950097 4:79760198-79760220 GTATTTTCACTATATCACACTGG - Intergenic
976223454 4:82776760-82776782 TTATTTTGTCTATGTAACAATGG + Intronic
979623256 4:122819220-122819242 GTAGTTTCACTCTGTCACCCAGG + Intergenic
979721017 4:123900456-123900478 GTAGTCTCACTCTGTCACACAGG - Intergenic
980758908 4:137202171-137202193 GTAATTTGAATATGTAACCTGGG - Intergenic
990005820 5:50943290-50943312 GTAGTTTCACTATGTTAGCCAGG - Intergenic
991221157 5:64219846-64219868 GTAGTTTCACTATGAAACACTGG - Intronic
993921320 5:93807485-93807507 TTAGTTTCACTATGAAACAGTGG - Intronic
996972823 5:129393851-129393873 GTATTTTAAATATGTCACACTGG - Intergenic
998315187 5:141176488-141176510 GTAGTATTACTATATATCACTGG + Intergenic
1007652244 6:43430280-43430302 GGAGTTTCACTGTGTTACACAGG + Intronic
1008011826 6:46475987-46476009 GTAGGTGGACTAAGTAACACTGG + Intronic
1009408505 6:63337608-63337630 GTAGTTTGGCCATGTTACCCTGG - Intergenic
1009981429 6:70730245-70730267 GTGGTTTCACTATGTTACCCAGG + Intronic
1011419833 6:87159526-87159548 GTAGTTTAACTCTGTCACCCAGG + Intronic
1012120442 6:95359990-95360012 GTATTTTGAATATTTAACAGAGG - Intergenic
1013911738 6:115283521-115283543 GTAGTCTTACTATGTTACCCAGG + Intergenic
1015232262 6:130928804-130928826 GTGGTTTTACTTTGTCACACTGG - Intronic
1015927300 6:138323199-138323221 GTATTTTGACAATGGAATACTGG + Intronic
1020603284 7:10303471-10303493 GTATTTTTACTATGTAAAACTGG - Intergenic
1029023553 7:97390575-97390597 GGAGTTTCACTCTGTCACACAGG + Intergenic
1029866702 7:103639181-103639203 GTAGTTTTACTAGAAAACACAGG + Intronic
1029930238 7:104363149-104363171 GTAGTTTGACTTTTAAACAAAGG - Intronic
1030751018 7:113232932-113232954 GAAATATGACTAAGTAACACAGG + Intergenic
1034926175 7:155124148-155124170 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926177 7:155124170-155124192 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926179 7:155124192-155124214 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926184 7:155124236-155124258 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926186 7:155124258-155124280 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926188 7:155124280-155124302 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926192 7:155124324-155124346 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926200 7:155124390-155124412 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926209 7:155124478-155124500 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926211 7:155124500-155124522 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926213 7:155124522-155124544 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926218 7:155124588-155124610 GTTGTTTGACTATGAGAAACCGG - Intergenic
1035391231 7:158506391-158506413 GTAGAATGACTAAGTGACACCGG + Intronic
1039390426 8:37176207-37176229 GTAGTTTCACTCTGTCACCCAGG + Intergenic
1040851705 8:51907596-51907618 CTTGTTTGAATATATAACACCGG - Intergenic
1042921170 8:73921460-73921482 GTAGTCTCACTCTGTAACTCAGG - Intergenic
1044969889 8:97608700-97608722 GGAGTCTGACTATGTTACCCAGG - Intergenic
1045696430 8:104813747-104813769 ACAGTTTGACTAAGTGACACAGG - Intronic
1046470287 8:114663658-114663680 GGAGTTGCACTATGTTACACAGG - Intergenic
1046834488 8:118784515-118784537 GTAGTTGGCATATGTTACACAGG + Intergenic
1047317942 8:123751878-123751900 GCAGCTTGACTATGGACCACAGG - Intergenic
1050262187 9:3852117-3852139 GTAGTCTCACTATGTCACCCAGG - Intronic
1052451269 9:28634509-28634531 GGAGTTTCACTCTGTAACCCAGG + Intronic
1053706586 9:40760090-40760112 GTAGTTTGAAACTGTAACTCAGG - Intergenic
1054416501 9:64880859-64880881 GTAGTTTGAAACTGTAACTCAGG - Intergenic
1056454863 9:86750592-86750614 GTAGATACACTATGTAACAGAGG - Intergenic
1057065741 9:92049223-92049245 ATAGTTCAACTCTGTAACACAGG + Intronic
1060676402 9:125519228-125519250 GTAGCTTGACTATGGACCTCAGG - Intronic
1185540642 X:900516-900538 GGAGTTTCACTCTGTCACACAGG - Intergenic
1185983190 X:4802486-4802508 ATAGTTTCACTATGTTACCCAGG - Intergenic
1187124569 X:16442622-16442644 GTAGCTGGCCAATGTAACACAGG - Intergenic
1187466831 X:19534984-19535006 GTAGTTTCACTATTAAACTCAGG + Exonic
1189832706 X:44990798-44990820 GTTATTTGACTATGTAACTTTGG + Intronic
1194226075 X:91259468-91259490 GGAGTTTCACCATGTCACACAGG + Intergenic