ID: 910312155

View in Genome Browser
Species Human (GRCh38)
Location 1:85836004-85836026
Sequence TCCTCATCTCCAAAAACGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910312151_910312155 1 Left 910312151 1:85835980-85836002 CCCTATACCTGGAGGAAAGGAGC 0: 2
1: 15
2: 41
3: 105
4: 288
Right 910312155 1:85836004-85836026 TCCTCATCTCCAAAAACGAAGGG No data
910312152_910312155 0 Left 910312152 1:85835981-85836003 CCTATACCTGGAGGAAAGGAGCA 0: 2
1: 14
2: 50
3: 89
4: 314
Right 910312155 1:85836004-85836026 TCCTCATCTCCAAAAACGAAGGG No data
910312153_910312155 -6 Left 910312153 1:85835987-85836009 CCTGGAGGAAAGGAGCATCCTCA 0: 2
1: 5
2: 27
3: 85
4: 301
Right 910312155 1:85836004-85836026 TCCTCATCTCCAAAAACGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910312155 Original CRISPR TCCTCATCTCCAAAAACGAA GGG Intronic
No off target data available for this crispr