ID: 910315484

View in Genome Browser
Species Human (GRCh38)
Location 1:85877656-85877678
Sequence TTAAAAACACACATGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910315484_910315486 21 Left 910315484 1:85877656-85877678 CCCAGCTTCATGTGTGTTTTTAA No data
Right 910315486 1:85877700-85877722 TTATATTAAAAAGAAAAGAGTGG 0: 1
1: 1
2: 23
3: 209
4: 1935

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910315484 Original CRISPR TTAAAAACACACATGAAGCT GGG (reversed) Intronic
No off target data available for this crispr