ID: 910316337

View in Genome Browser
Species Human (GRCh38)
Location 1:85888175-85888197
Sequence GCAGGACCTTTTTTATGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910316337_910316341 18 Left 910316337 1:85888175-85888197 CCTGCTCATAAAAAAGGTCCTGC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 910316341 1:85888216-85888238 TTGCAACAGCCAGCCATTCTTGG 0: 1
1: 0
2: 1
3: 11
4: 113
910316337_910316338 -9 Left 910316337 1:85888175-85888197 CCTGCTCATAAAAAAGGTCCTGC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 910316338 1:85888189-85888211 AGGTCCTGCCATTTTTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910316337 Original CRISPR GCAGGACCTTTTTTATGAGC AGG (reversed) Intronic
903428579 1:23273632-23273654 CCAGGACCATTTTTCTGAGAGGG + Intergenic
906291920 1:44625069-44625091 ACAGGAGCTTTTTCATGGGCCGG + Intronic
906548194 1:46637683-46637705 TCAGGACATTTCTCATGAGCAGG + Intronic
908381409 1:63600153-63600175 GCAGGACTCTTTTTTAGAGCCGG + Intronic
909107533 1:71431115-71431137 AAAAGACCTTTTTTATGATCAGG + Intronic
909244564 1:73262831-73262853 GCAGAGCCATTTTTATGTGCTGG - Intergenic
910316337 1:85888175-85888197 GCAGGACCTTTTTTATGAGCAGG - Intronic
922300966 1:224300499-224300521 GCAGGATCTTTAATATAAGCTGG + Intronic
1063783277 10:9350867-9350889 GCAGGCTCTGTCTTATGAGCTGG + Intergenic
1064434957 10:15303183-15303205 TCAGGACTTTTTTTTTGAGATGG - Intronic
1065142558 10:22733350-22733372 GCAGGAGTTTTTTTCTGAACAGG - Intergenic
1065264235 10:23958256-23958278 ACAGCACCTTATGTATGAGCTGG - Intronic
1066243955 10:33563827-33563849 ACCTGATCTTTTTTATGAGCTGG - Intergenic
1075491399 10:122873427-122873449 AAAGGAACTTTTTTCTGAGCAGG - Intronic
1077276750 11:1715046-1715068 GCAGGGGCTTCTTTGTGAGCTGG + Intergenic
1080857208 11:36122590-36122612 GCAGGAACTGTTTTAGGTGCTGG + Intronic
1083256170 11:61496642-61496664 CCAGGACCTTTGTGATGGGCAGG + Intergenic
1087708574 11:101522716-101522738 GCAGGCCCTGTTTTATGCACTGG - Intronic
1095940493 12:47723873-47723895 TCAGGTCCTCCTTTATGAGCTGG - Intronic
1102619994 12:114186744-114186766 TCAGGACCTTCTGCATGAGCGGG + Intergenic
1103253609 12:119521993-119522015 GCAGGACCTTTTCTATGGGGAGG + Intronic
1110015714 13:70398983-70399005 TCAGGACCATTTTTATGGCCTGG - Intergenic
1113345250 13:109471448-109471470 GAAGGACATTTTTTAAAAGCAGG - Intergenic
1114790452 14:25651976-25651998 GCAGGAGCATTTTTAAGTGCTGG + Intergenic
1117694957 14:58351568-58351590 GCAGGACCTTTCTTTTGACTGGG - Intronic
1118944594 14:70372659-70372681 GCAATACCTTTTTTCTTAGCTGG - Exonic
1121558245 14:94854715-94854737 GCAGGACCATTTTTTTGTGATGG - Intergenic
1130753770 15:86741221-86741243 GCAGGACTGTTTATATTAGCAGG + Intronic
1135990365 16:27215193-27215215 TCAGGTCCTTTTTAATGGGCAGG + Intronic
1139876423 16:70149793-70149815 CCAGAACCTTTTTTTTGAGACGG + Intronic
1140588323 16:76321439-76321461 GTAGGTGCTTTTTTATGAGTTGG + Intronic
1142305373 16:89281474-89281496 GCAGGACCTCTTTCATGTGAGGG + Exonic
1145773977 17:27513834-27513856 GGAGGACCTGTGTGATGAGCAGG - Intronic
1147455326 17:40534313-40534335 GCAAGTCCTTTTTTTTGGGCCGG + Intergenic
1149229966 17:54521556-54521578 GCAGGACATAATTTTTGAGCAGG + Intergenic
1151637720 17:75363263-75363285 GCAGTTCCTTATTTATGAGTGGG - Intronic
1151763169 17:76118895-76118917 CCAGGACTTTTTTTAGGAGGGGG - Intronic
1154324375 18:13379571-13379593 GCAGGCACTATTTTAGGAGCTGG - Intronic
1155903410 18:31419445-31419467 GCAGGCCCAATTTTATGAGGTGG + Intergenic
1156574133 18:38294120-38294142 GCAGTGACTTTTTTATGAGACGG + Intergenic
1156960478 18:43022724-43022746 TCAGGACATTATTTCTGAGCTGG - Intronic
1158229047 18:55233513-55233535 CCAGGACCTTTCTTATCAGGAGG - Intronic
1159449552 18:68583210-68583232 GCAGGACCTTGTCAATTAGCAGG - Intergenic
1162208219 19:9071828-9071850 GCAGAACCTGTTTTATGACATGG + Intergenic
1162639783 19:11999315-11999337 CCAGGTCCTTTTTTTTGAGACGG - Intergenic
1162833529 19:13301721-13301743 GCATGACTTTTCTTATGGGCGGG - Intronic
1162938199 19:13992451-13992473 GCAGGACCTGTGTTGAGAGCAGG - Intronic
1168234664 19:55054579-55054601 GCAAGACCTTTTTTTTGAGATGG - Intronic
925826233 2:7850755-7850777 CCAGGAGATTTTTTATTAGCAGG + Intergenic
926056883 2:9778931-9778953 GCAGGCTCATTTTTATGAGGAGG + Intergenic
927971765 2:27310108-27310130 TCAGCACCTTTTTTTTGAGATGG + Intronic
930386273 2:50699438-50699460 GCAGGAGCTTTGTTTGGAGCAGG + Intronic
930822296 2:55658675-55658697 GCAGGTTCTTTGTCATGAGCTGG - Intronic
930845658 2:55900754-55900776 GCAGGACCTATAATATGAGATGG - Intronic
931215685 2:60242055-60242077 GCAGGACCTCTTTTATCTGAGGG - Intergenic
932746445 2:74337467-74337489 TCAGCACCTTTTTAAAGAGCGGG + Intronic
935321230 2:101891224-101891246 GCAGGACTTCTCTTCTGAGCTGG + Exonic
940186440 2:150989821-150989843 GCATGATCTTTTTAATGTGCTGG - Intergenic
940540492 2:155009972-155009994 CCAGGACATTTTTCATTAGCTGG + Intergenic
941876239 2:170436426-170436448 GCAGGAGCTTTATAATGAGTGGG - Intronic
944679025 2:202059594-202059616 GCAGAAGCTTTTTTTTGAGATGG - Intergenic
947808830 2:232987321-232987343 GCAGGACTTTTTTGATGTTCTGG + Intronic
947863640 2:233380628-233380650 ACAGGACCTTGTTTCTGAACTGG - Intronic
948543205 2:238704450-238704472 CCAGGACCTCCTTTATGATCTGG + Intergenic
1168933890 20:1646581-1646603 GCAGAACCTTTCTAATGAGAGGG + Intronic
1168949188 20:1784895-1784917 GCACAACCTTTTATAGGAGCTGG + Intergenic
1168956617 20:1838695-1838717 TTATGACCTGTTTTATGAGCGGG + Intergenic
1174100373 20:48122415-48122437 CCAGAACCTTTTTGAGGAGCTGG - Intergenic
1174555701 20:51393972-51393994 GCAGGACCATTTCCATCAGCAGG - Intronic
1175440689 20:58988955-58988977 GCGGGACCTTTTTTATAAACTGG + Exonic
1179377151 21:40860679-40860701 ACAGGACGTTTTTTGTGGGCTGG - Intergenic
950272840 3:11632841-11632863 CCAGGAACTGTTTTATGTGCTGG - Intronic
952286906 3:31978356-31978378 GCAGGAACTGTTCTAGGAGCTGG - Intronic
952751928 3:36831668-36831690 GCAGGACCTGCTCTTTGAGCGGG - Exonic
955856993 3:63283488-63283510 GCTGGACCTATTTTATCATCAGG - Intronic
956655150 3:71542783-71542805 GCAGGCCGGGTTTTATGAGCTGG - Intronic
964808970 3:160641962-160641984 GCATGACTTTTTTAATGGGCTGG + Intergenic
968976631 4:3825483-3825505 GCAGGCCCTGTTTTAGGGGCTGG - Intergenic
970475472 4:16417709-16417731 GCAGGAACTTTCTTATCATCTGG + Intergenic
974421223 4:61677847-61677869 GCAGGACATTACTCATGAGCTGG + Intronic
974731969 4:65878452-65878474 GCAGGAAAATTTTTAGGAGCTGG - Intergenic
983877146 4:172890843-172890865 GAAGTACCTGTTTTATGATCTGG + Intronic
984921297 4:184766539-184766561 GGAGGGCCTTTTTTGTGAGAGGG - Intronic
987061712 5:14249632-14249654 GCAGGACACATTTTGTGAGCAGG + Intronic
992099429 5:73392531-73392553 GCAGGATCATTTCTATAAGCTGG + Intergenic
993126651 5:83844043-83844065 GCAGTACCTTTTTGTTGGGCTGG - Intergenic
998993709 5:147847585-147847607 GCAAGACATTTTTTCTGGGCAGG - Intergenic
1001160506 5:169308457-169308479 GTGGGACAATTTTTATGAGCAGG - Intergenic
1006063743 6:31445474-31445496 GCAGGACCTTTGTGATGCTCAGG + Intergenic
1006650181 6:35545001-35545023 CCAGGACCATGTTTAAGAGCTGG + Intergenic
1008153553 6:47986985-47987007 GCAAAACCTTTTTTTTGAGAAGG + Intronic
1013227461 6:108130416-108130438 GCAGGGCCTTTCTCAAGAGCTGG - Intronic
1013822282 6:114168772-114168794 GCAGAACCTTGTTTCTGATCTGG + Intronic
1017462335 6:154663099-154663121 GCAGGAATTTGTTTAAGAGCAGG + Intergenic
1022317687 7:29260773-29260795 ACCGGACCTGTTTTATGAGGTGG + Intronic
1027524570 7:79251242-79251264 GCAGGACCTTTTTTACTTGATGG - Intronic
1029650930 7:101890982-101891004 GCAGGATTTTTTTTTTGAGCGGG + Intronic
1034682139 7:152936990-152937012 GCAGGAAAGTTTTTAAGAGCTGG - Intergenic
1034753688 7:153594316-153594338 GCAGGAGAGTTTTTAAGAGCTGG - Intergenic
1037025040 8:14024990-14025012 GGAGGACCTCTTTTAAGAGATGG - Intergenic
1038032282 8:23653070-23653092 GCATGATCTTATTTATGTGCTGG + Intergenic
1041768864 8:61451066-61451088 GCAGGACATTTAGTGTGAGCAGG + Intronic
1051059507 9:13029827-13029849 GGAAGACCTTTTTAATGAGCTGG + Intergenic
1052233817 9:26187274-26187296 GCAGGAGAATTTTTAGGAGCTGG + Intergenic
1060744896 9:126124807-126124829 GCAAGACCTTTGTTTTGACCTGG + Intergenic
1062563054 9:137150385-137150407 GGAGGACCTTTTTTCTGGGCGGG - Intronic
1062563138 9:137150679-137150701 GCAGGTCTTTTTTTCTGGGCGGG - Intronic
1186108382 X:6229340-6229362 ACAGGACCTGTTTTATGCTCAGG + Intergenic
1186860938 X:13671865-13671887 GCAGTTCCTTTTTTTTGAGACGG + Intronic
1189942287 X:46137209-46137231 GTAGGACCTGTTTGATGAGGTGG + Intergenic
1198639858 X:138744682-138744704 TCAGGACCTTTGTCATGTGCAGG + Intronic