ID: 910320332

View in Genome Browser
Species Human (GRCh38)
Location 1:85936591-85936613
Sequence GAGTGTTAATTCCTCTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910320332_910320336 -4 Left 910320332 1:85936591-85936613 CCAAGATAGAGGAATTAACACTC No data
Right 910320336 1:85936610-85936632 ACTCTGGCAAGGACCCCAGGAGG No data
910320332_910320341 18 Left 910320332 1:85936591-85936613 CCAAGATAGAGGAATTAACACTC No data
Right 910320341 1:85936632-85936654 GTTGCACAAGCTCCTACAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 95
910320332_910320340 17 Left 910320332 1:85936591-85936613 CCAAGATAGAGGAATTAACACTC No data
Right 910320340 1:85936631-85936653 GGTTGCACAAGCTCCTACAGTGG No data
910320332_910320335 -7 Left 910320332 1:85936591-85936613 CCAAGATAGAGGAATTAACACTC No data
Right 910320335 1:85936607-85936629 AACACTCTGGCAAGGACCCCAGG 0: 2
1: 2
2: 11
3: 36
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910320332 Original CRISPR GAGTGTTAATTCCTCTATCT TGG (reversed) Intronic