ID: 910320335

View in Genome Browser
Species Human (GRCh38)
Location 1:85936607-85936629
Sequence AACACTCTGGCAAGGACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 2, 1: 2, 2: 11, 3: 36, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910320332_910320335 -7 Left 910320332 1:85936591-85936613 CCAAGATAGAGGAATTAACACTC No data
Right 910320335 1:85936607-85936629 AACACTCTGGCAAGGACCCCAGG 0: 2
1: 2
2: 11
3: 36
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910320335 Original CRISPR AACACTCTGGCAAGGACCCC AGG Intronic