ID: 910320336

View in Genome Browser
Species Human (GRCh38)
Location 1:85936610-85936632
Sequence ACTCTGGCAAGGACCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910320332_910320336 -4 Left 910320332 1:85936591-85936613 CCAAGATAGAGGAATTAACACTC No data
Right 910320336 1:85936610-85936632 ACTCTGGCAAGGACCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910320336 Original CRISPR ACTCTGGCAAGGACCCCAGG AGG Intronic