ID: 910320341

View in Genome Browser
Species Human (GRCh38)
Location 1:85936632-85936654
Sequence GTTGCACAAGCTCCTACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910320332_910320341 18 Left 910320332 1:85936591-85936613 CCAAGATAGAGGAATTAACACTC No data
Right 910320341 1:85936632-85936654 GTTGCACAAGCTCCTACAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910320341 Original CRISPR GTTGCACAAGCTCCTACAGT GGG Intronic