ID: 910321111

View in Genome Browser
Species Human (GRCh38)
Location 1:85945450-85945472
Sequence GTCATACAAAACCACACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910321111_910321112 -7 Left 910321111 1:85945450-85945472 CCTTGAGTGTGGTTTTGTATGAC No data
Right 910321112 1:85945466-85945488 GTATGACCTTTCTCTTGTACTGG 0: 1
1: 0
2: 1
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910321111 Original CRISPR GTCATACAAAACCACACTCA AGG (reversed) Intronic
No off target data available for this crispr