ID: 910331206

View in Genome Browser
Species Human (GRCh38)
Location 1:86073943-86073965
Sequence ATGCTCCCTCCTTGTAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910331206_910331209 -9 Left 910331206 1:86073943-86073965 CCTGCCTTACAAGGAGGGAGCAT No data
Right 910331209 1:86073957-86073979 AGGGAGCATTAAATATGGAAAGG 0: 1
1: 68
2: 1210
3: 5906
4: 3829

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910331206 Original CRISPR ATGCTCCCTCCTTGTAAGGC AGG (reversed) Intronic
No off target data available for this crispr