ID: 910337058

View in Genome Browser
Species Human (GRCh38)
Location 1:86145974-86145996
Sequence TCTTACATTCTCATGGTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910337054_910337058 -1 Left 910337054 1:86145952-86145974 CCCTCAAAATTGGTTTCTTTAAT 0: 1
1: 0
2: 2
3: 33
4: 514
Right 910337058 1:86145974-86145996 TCTTACATTCTCATGGTACTGGG 0: 1
1: 0
2: 1
3: 13
4: 160
910337055_910337058 -2 Left 910337055 1:86145953-86145975 CCTCAAAATTGGTTTCTTTAATC 0: 1
1: 0
2: 0
3: 37
4: 432
Right 910337058 1:86145974-86145996 TCTTACATTCTCATGGTACTGGG 0: 1
1: 0
2: 1
3: 13
4: 160
910337053_910337058 0 Left 910337053 1:86145951-86145973 CCCCTCAAAATTGGTTTCTTTAA 0: 1
1: 0
2: 1
3: 48
4: 457
Right 910337058 1:86145974-86145996 TCTTACATTCTCATGGTACTGGG 0: 1
1: 0
2: 1
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910337058 Original CRISPR TCTTACATTCTCATGGTACT GGG Intronic
902649028 1:17824676-17824698 TCTGACATTCACATGTAACTGGG + Intronic
903975188 1:27145125-27145147 GCTTACATTCTTATGGAAATTGG + Intronic
909530979 1:76681495-76681517 TCTTACAATTTAATGGGACTTGG + Intergenic
910337058 1:86145974-86145996 TCTTACATTCTCATGGTACTGGG + Intronic
911229998 1:95351059-95351081 TCTAAGATCCTCATGGTTCTAGG - Intergenic
911503443 1:98717988-98718010 TCTTGCATTTTCCTGGTACAAGG - Intronic
915733773 1:158071922-158071944 TTTTACATTGTAATGCTACTGGG + Intronic
915733961 1:158072898-158072920 TTTTACATTGTAATGCTACTGGG - Intronic
916183310 1:162106441-162106463 ACTTACATTTTCTTGCTACTGGG + Intronic
916476758 1:165176985-165177007 TGTTACATGCCCATGGTCCTAGG - Intergenic
916488240 1:165278451-165278473 TCTCACATTCTCTTACTACTTGG + Intronic
918409758 1:184246154-184246176 CATTAGATTCTCATGGGACTAGG - Intergenic
919121766 1:193349702-193349724 TGTTCCATTTTCAAGGTACTGGG + Intergenic
919249553 1:195035010-195035032 TCTTACAGACTCATGGTAAAGGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922549231 1:226481899-226481921 TCTTACATTCTCCTAGTCTTTGG + Intergenic
1063047907 10:2412374-2412396 TCTTATTTTCTCAGGGTTCTTGG + Intergenic
1063402559 10:5760764-5760786 ACTTACATTCTCATGCTTGTTGG - Intronic
1066033304 10:31452186-31452208 TCTAACATGTTCATGGTACTTGG + Intronic
1068686711 10:59877868-59877890 TTTTACTTTCTCATTGTATTTGG - Intronic
1070713270 10:78699070-78699092 TATTGCATTCCCATGGCACTGGG + Intergenic
1071896957 10:90078067-90078089 TCTTAAATTCACCTGGTAATTGG + Intergenic
1072755983 10:98021268-98021290 TCTTACATTTTCTTGGTGCTGGG - Intronic
1072773865 10:98169128-98169150 TCTTTCATTCTTATCTTACTTGG + Intronic
1073200721 10:101733019-101733041 TCTTGCATCTTCATGCTACTGGG - Intergenic
1074503718 10:114048114-114048136 TCTTACATACTCATGGTCGGGGG - Intergenic
1076045935 10:127294143-127294165 TCTTCCATCCTCATGGTACTTGG + Intronic
1078200798 11:9180966-9180988 TCTGAGATTCTCATGGCATTTGG - Exonic
1082861865 11:57864379-57864401 TATTACATTGGCATGGTTCTGGG - Intergenic
1086546217 11:87970665-87970687 TCTGACATTCTCCAGGTAGTTGG + Intergenic
1087288455 11:96293238-96293260 TCTAACATTCTCAGTGAACTTGG - Intronic
1090400264 11:126444335-126444357 TCTTAAATTCTCATGGGGCCAGG + Intronic
1092509911 12:9144046-9144068 CCTGACTTTCTCATGGTACCCGG - Intergenic
1092951134 12:13504606-13504628 TCTCCCCTTCTCCTGGTACTGGG - Intergenic
1094278583 12:28708458-28708480 TCTTATATGCTAATGGTACCTGG + Intergenic
1095285960 12:40410591-40410613 TCCTACATTTACATGGTAGTTGG + Intronic
1095512576 12:42969129-42969151 TCTTACTTTCTCATGTTTTTGGG + Intergenic
1096719737 12:53512223-53512245 TCTCACAATCTCCTGGGACTGGG - Exonic
1096934304 12:55254528-55254550 TCTTAAATCCTCATGTCACTTGG - Intergenic
1097388563 12:58980625-58980647 TTTTACAATCTCAGGGTACAAGG + Intergenic
1097808669 12:63993381-63993403 TCTTCCATTGTTATGGTTCTAGG + Intronic
1099591438 12:84596073-84596095 TCATACATTTTCATCTTACTTGG - Intergenic
1100057085 12:90524868-90524890 TTCTTCATTCTCATGATACTGGG + Intergenic
1100222664 12:92522655-92522677 TCTCACATTCTCGTGATGCTTGG + Intergenic
1102614540 12:114141978-114142000 TCCTTCATTCTCATGCTTCTTGG + Intergenic
1102836670 12:116068981-116069003 TTTATCATTCTCATGGCACTCGG - Intronic
1106035856 13:26044552-26044574 TTTTTCATTTTCATTGTACTTGG - Intergenic
1109489387 13:63076180-63076202 TTTCACATTCTCATGGGATTTGG + Intergenic
1112248717 13:97758160-97758182 TCTTTCATTCCCATGATATTTGG + Intergenic
1112575403 13:100631207-100631229 TCTTGCATTTACATGTTACTGGG - Intronic
1113638809 13:111942760-111942782 TCTTACATTGTCACGGTGCAAGG - Intergenic
1114886818 14:26862944-26862966 TCTAAGATTCTCATAATACTGGG + Intergenic
1115410282 14:33066454-33066476 TTTTAATTTATCATGGTACTTGG + Intronic
1115659898 14:35483277-35483299 TCTTAGATTATCTTGGTAGTTGG + Intergenic
1117486162 14:56199408-56199430 ACTTTCATTCTCATGGTTCTTGG - Intronic
1120515343 14:85463854-85463876 TCATGCATTCTCCTGCTACTAGG + Intergenic
1120959700 14:90113602-90113624 TCTTACATTACCATGGCACATGG - Intronic
1125059947 15:35407521-35407543 GCTTACATTGTAATGGTACAGGG + Intronic
1131544529 15:93305089-93305111 TCTGACATTCTGATAGTTCTGGG + Intergenic
1133077012 16:3287935-3287957 TTTTAAATATTCATGGTACTTGG - Intronic
1134859580 16:17549134-17549156 GATTACATCCTGATGGTACTGGG + Intergenic
1135221235 16:20615491-20615513 TCTTACATTTTGATAGTACCTGG - Intronic
1135608164 16:23840711-23840733 TATTACATTGTCATGGAAATTGG + Intronic
1137763152 16:50956915-50956937 TCTGTCATTGTGATGGTACTGGG + Intergenic
1137867258 16:51913170-51913192 TTTGACAGTCTCATGGTGCTGGG - Intergenic
1143312305 17:6002267-6002289 TTTTTCATTTTCATGGGACTGGG + Intronic
1143854395 17:9838063-9838085 TCTCACATTCTCATGCTTCTTGG - Intronic
1144133804 17:12273415-12273437 TCTTTCATTCTCATTGTTTTTGG - Intergenic
1144178157 17:12728430-12728452 TCTCACCTTTTCATGGGACTGGG + Intronic
1148633355 17:49129043-49129065 CCTTTCTTTCTCATGGTACTCGG - Intergenic
1159490329 18:69124749-69124771 TCTTACATTCTAATGGCATTTGG - Intergenic
1159891904 18:73961076-73961098 ACTCACATTCTCATGGGACATGG + Intergenic
1162183366 19:8886035-8886057 TCTTGCATTCTCATGGCATGGGG + Intronic
1163255447 19:16153304-16153326 TCTGTCACTCTCATGGTCCTTGG + Intronic
1164094727 19:21997266-21997288 TCCTAAATTCACATGGTAGTTGG + Intronic
1165617951 19:37218726-37218748 TCTCACATTCTCACGTTACTGGG - Intronic
1166033220 19:40148387-40148409 TCTTTCATTCTCATTTTTCTTGG + Intergenic
1168079555 19:53999540-53999562 TCTTACATCTTCCTGGTTCTGGG + Intronic
1168300203 19:55400625-55400647 TCTTCCATGCTCATGGTTGTTGG - Exonic
925132364 2:1503018-1503040 TCGCACATTCTCATCGTCCTGGG + Intronic
925987388 2:9227200-9227222 TCCTACATTTTCAGGGCACTTGG + Intronic
926623487 2:15069997-15070019 TCTGACATTCTCATGGTGGGGGG - Intergenic
927627912 2:24743009-24743031 TCTTCCATTCTCTTTGTCCTGGG + Intronic
930846370 2:55909150-55909172 CCTTATATACACATGGTACTTGG + Intronic
932857398 2:75250688-75250710 TCTTACATTAACATGGTTCATGG + Intergenic
935489281 2:103697243-103697265 TTTTACATTCCCATAGTTCTTGG + Intergenic
936756539 2:115720276-115720298 ACTTACATTCTTTTGGTAGTAGG - Intronic
937400628 2:121580674-121580696 TCTTATATTCTCCTAGTGCTGGG + Intronic
939636272 2:144586101-144586123 TCTTACATACATATTGTACTTGG + Intergenic
939658618 2:144859290-144859312 TCTTTCCTTTTCTTGGTACTTGG - Intergenic
939893569 2:147766126-147766148 TCTTACATTGTCAAGTTTCTTGG - Intergenic
941278084 2:163516199-163516221 TCCTACAAACACATGGTACTTGG - Intergenic
943867626 2:192948190-192948212 TCTGAGATTCTCATGAAACTGGG - Intergenic
945589328 2:211710352-211710374 TCTTACATTCATGTGGTATTTGG + Intronic
946489225 2:220131701-220131723 TTTAACATGCTCATGGTTCTGGG - Intergenic
947051695 2:226051525-226051547 TCTTTTATTCTTATGGTTCTAGG - Intergenic
948015380 2:234685917-234685939 TCTTACATTATCATTGTGATAGG + Intergenic
1173419987 20:42892695-42892717 ACATACATTCTCATGATTCTTGG + Intronic
1173831388 20:46091196-46091218 TCTTAAATTTTCATAGTATTAGG - Intergenic
1175072774 20:56348336-56348358 TCTTACATTCACTTGGTAATTGG - Intergenic
1175154970 20:56964750-56964772 TTTTACATTTTTTTGGTACTAGG + Intergenic
1175203182 20:57291892-57291914 TCTTGCATAATCATGGTACAAGG + Intergenic
1175465373 20:59187128-59187150 TCTTCCATTCTCAGGGATCTTGG - Intergenic
1182350654 22:29697491-29697513 TCTTTCTTTCTCCTGCTACTGGG - Exonic
1182756501 22:32683913-32683935 TCTTAGGTTCTCTTGCTACTGGG + Intronic
1184009443 22:41735979-41736001 ATTTACCTTCTCATGGTTCTAGG + Intronic
951659046 3:25041888-25041910 TTTTACATTCTCATGTTCCATGG - Intergenic
951689342 3:25379407-25379429 TCTGACATACCCATGGCACTAGG - Intronic
952113142 3:30147959-30147981 TCTTTCTTTCTCCTGGTACAGGG + Intergenic
952184503 3:30954025-30954047 TATTAGATTCTCATAGGACTAGG + Intergenic
955523344 3:59796235-59796257 CATTTCATTCTCATTGTACTGGG - Intronic
955825341 3:62940194-62940216 TATAACATTTTTATGGTACTGGG - Intergenic
957531574 3:81446685-81446707 TCATACATGCTCATCTTACTGGG - Intergenic
963965029 3:151358250-151358272 TCTTACATTCTGATGTTTTTAGG - Intronic
965606219 3:170499970-170499992 TTTTATCTTGTCATGGTACTTGG + Intronic
965875109 3:173307382-173307404 TATTAAATTTTCATGATACTGGG + Intergenic
967333344 3:188315619-188315641 GCTTACATTCTAATGGGTCTGGG - Intronic
968782530 4:2593926-2593948 ACATGGATTCTCATGGTACTCGG + Intronic
970238953 4:13988228-13988250 TCTTTCATTATCATGGCAATAGG + Intergenic
972701585 4:41499326-41499348 TCTTACATTCAAATGGTTCAGGG - Intronic
972869169 4:43274805-43274827 TCTTTTATTCTCATCCTACTAGG + Intergenic
976349841 4:84048900-84048922 TTTTACATTCTCAATCTACTTGG + Intergenic
979611721 4:122696541-122696563 TCTTAAATTCACCTGGTATTTGG + Intergenic
979790091 4:124768970-124768992 TTTTACTTTCTCATGATTCTAGG - Intergenic
979825450 4:125227712-125227734 TCTTTCATCCTCATGCTTCTTGG - Intergenic
980723989 4:136734470-136734492 TCTTAAATTCACTTGGTAATTGG - Intergenic
981655281 4:147105445-147105467 TCTAACATTCTCCTGGTAGGGGG + Intergenic
982861761 4:160460779-160460801 ACATATATTCTCATGGTAATGGG - Intergenic
987044534 5:14094781-14094803 TCTTCCCTCCTCATGGTTCTAGG + Intergenic
988044436 5:25931848-25931870 TCTTTAATTCACATGGTATTGGG + Intergenic
988854203 5:35211551-35211573 TTTTACATTATTATGGTATTGGG - Intronic
992957749 5:81927768-81927790 ATTTACTTTCTCATGGTTCTGGG + Intergenic
995358351 5:111265102-111265124 GCTTACATTCTCATGACAATGGG - Intronic
995672999 5:114628323-114628345 TCTAACTTTCTCATCTTACTTGG - Intergenic
996356814 5:122604588-122604610 TTGTTCATTCTCATGCTACTTGG - Intergenic
1003998595 6:11569816-11569838 TATTACATTCTCAAAGTACAGGG + Intronic
1005008721 6:21315164-21315186 TCTTATATTGTCATTGTACTTGG - Intergenic
1006914435 6:37585300-37585322 TCCTACATTCACATGGCCCTGGG - Intergenic
1008620549 6:53267101-53267123 TCTAACATTCTCAGGGTAAGGGG + Intergenic
1009568191 6:65341584-65341606 TCTTTCATTTTCATGCTTCTGGG + Intronic
1013916830 6:115349580-115349602 TCTTATATAATCATGGTACCAGG + Intergenic
1014947777 6:127516934-127516956 CCTTACATTCTCATGGTAGCAGG + Intronic
1015650072 6:135446792-135446814 TCTTACATTCTTTGGGCACTTGG - Intronic
1016268642 6:142261505-142261527 TCTAACATTCTTATGATATTGGG + Intergenic
1016543777 6:145196942-145196964 ACTTACATTTACATGATACTGGG - Intergenic
1022035145 7:26527128-26527150 TTATATACTCTCATGGTACTGGG + Intergenic
1022953006 7:35356230-35356252 TCTTAAATTCTCTTTTTACTAGG - Intergenic
1028066370 7:86390478-86390500 CATTACATTCTCTTGGTTCTTGG + Intergenic
1030480369 7:110096139-110096161 TATTACATTCTCATGGAAATAGG + Intergenic
1030940692 7:115645237-115645259 TCTTACCTCATCATGGTATTAGG + Intergenic
1031969990 7:128057534-128057556 GCTTACATTCTCAGGGTCCAAGG + Intronic
1035132677 7:156669905-156669927 TGTTTCATTTTCATGGCACTAGG - Intronic
1037509247 8:19564805-19564827 GCTTACATTCTCATGGGGCAAGG - Intronic
1045812366 8:106237741-106237763 TCCTACATTATCAGGTTACTTGG - Intergenic
1046788189 8:118291086-118291108 TTTAACATTTTCATTGTACTAGG - Intronic
1048571116 8:135657683-135657705 CCTGACATTCTCATGGTGTTTGG - Intergenic
1048687669 8:136922783-136922805 TATTAGATTCTCTTGGTAATTGG + Intergenic
1050500270 9:6290689-6290711 TCTTACATTCTGCTGGAGCTAGG - Intergenic
1050619637 9:7439450-7439472 TATTACAGTATCATGTTACTTGG + Intergenic
1052532078 9:29699204-29699226 TTTTACATTTTTATGGTACAGGG + Intergenic
1053558965 9:39169688-39169710 TCTTACATTCACCTGGTGATTGG - Intronic
1053823087 9:41989935-41989957 TCTTACATTCACCTGGTGATTGG - Intronic
1054138146 9:61449255-61449277 TCTTACATTCACCTGGTGATTGG + Intergenic
1054607486 9:67197431-67197453 TCTTACATTCACCTGGTGATTGG + Intergenic
1056770711 9:89476100-89476122 TCTTACATTCTAATGGCACCAGG - Intronic
1057215865 9:93228523-93228545 TCTGACATTCCCATGGGAATTGG + Intronic
1059978498 9:119743675-119743697 CTTATCATTCTCATGGTACTGGG + Intergenic
1061107245 9:128540726-128540748 TTTTACAATCTCTTGGCACTTGG - Intronic
1061913159 9:133735413-133735435 TCTTGCATTCTCATTGTTATTGG - Intronic
1188052126 X:25500671-25500693 TAATATATTCTCATGCTACTTGG - Intergenic
1192388501 X:70699088-70699110 TGTTACATCCTCAGGGTAGTTGG - Intronic
1197124560 X:122929180-122929202 TCATTTATTCTCATGGTAATGGG + Intergenic
1200641592 Y:5725293-5725315 TCTTAAATTCCCATGGTTTTAGG - Intronic
1200855643 Y:7935175-7935197 TTTTACATTATCAGGGTGCTGGG + Intergenic
1200921480 Y:8617277-8617299 ACATACATTCTCATGGTGCTGGG + Intergenic