ID: 910337326

View in Genome Browser
Species Human (GRCh38)
Location 1:86149269-86149291
Sequence GTTTTAAAATGCCTGTGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910337326_910337328 8 Left 910337326 1:86149269-86149291 CCATAACACAGGCATTTTAAAAC 0: 1
1: 0
2: 0
3: 35
4: 264
Right 910337328 1:86149300-86149322 CTGATTCTAATGTGCAAACAAGG 0: 1
1: 2
2: 22
3: 185
4: 625
910337326_910337329 14 Left 910337326 1:86149269-86149291 CCATAACACAGGCATTTTAAAAC 0: 1
1: 0
2: 0
3: 35
4: 264
Right 910337329 1:86149306-86149328 CTAATGTGCAAACAAGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910337326 Original CRISPR GTTTTAAAATGCCTGTGTTA TGG (reversed) Intronic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
904231345 1:29076060-29076082 TCTTTAAAATGCCTCTGTTCAGG - Intronic
904788943 1:33003490-33003512 AGATTAAAATGCCTGTGTTTAGG + Intergenic
905598743 1:39232057-39232079 GTCTTAACATGCCTCTGTTATGG - Intronic
905598747 1:39232177-39232199 GTCTTAACATGCCTCTGTTTTGG - Intronic
905723848 1:40231252-40231274 TTTTTTAAATGCCACTGTTAAGG + Intronic
908025500 1:59947394-59947416 GTTTTATATTGCCTGTCTTAAGG - Intergenic
908393170 1:63701849-63701871 GTGTTAAGATGCCTGGGTTCTGG - Intergenic
908560903 1:65305298-65305320 GTTTTTGAATGTCTATGTTATGG - Intronic
909024433 1:70466613-70466635 GTTCTAAAATGCCTGTACAAAGG + Intergenic
909105910 1:71408117-71408139 CTTTTAAATTGCCTGGGTAAGGG + Intronic
909234997 1:73141478-73141500 TTTTTTAAATTCCTGTGGTATGG + Intergenic
909670071 1:78178607-78178629 TATTTAAAATGCCTATGTTTTGG - Intergenic
910060383 1:83084751-83084773 GTTTTAAAATTCCTTTTTTTAGG + Intergenic
910337326 1:86149269-86149291 GTTTTAAAATGCCTGTGTTATGG - Intronic
910505077 1:87941282-87941304 TTATTAAGATGCCTGTTTTATGG + Intergenic
911325663 1:96468618-96468640 GTTTCAAAATGCCTCTTTAAAGG + Intergenic
911947673 1:104133215-104133237 GGTTTCAAATTCCTGTGTTCAGG - Intergenic
912228227 1:107760890-107760912 GTTTTAAAAACACTTTGTTAGGG + Intronic
912601279 1:110935396-110935418 AATTTAAAATAGCTGTGTTAAGG + Intergenic
912678137 1:111705211-111705233 TTTTTAAAAGGCTTATGTTAAGG - Intronic
913268343 1:117067229-117067251 GCTTTAAAAAGCTTGTCTTAGGG + Intronic
914959243 1:152191503-152191525 GTGTTAAAAGTCCTGGGTTATGG + Intergenic
916491709 1:165307901-165307923 TTTTTAAAAAGACTGTGTGAAGG + Intronic
918693174 1:187508293-187508315 GTGTCAACTTGCCTGTGTTAAGG + Intergenic
919527215 1:198668470-198668492 GTATTAAAATGTGCGTGTTATGG + Intronic
919581907 1:199387050-199387072 TTTTTACAATACCTGTGTTCTGG - Intergenic
919656986 1:200206825-200206847 GTTTTAAACTATCTGAGTTAGGG - Intergenic
920389347 1:205589285-205589307 GTGTTCAAAGGCCTGGGTTAGGG + Intronic
921503589 1:215938426-215938448 TTTTTAAAATGCTTGTGCTCAGG + Intronic
923418288 1:233787001-233787023 TTTTTAAAATGTCTTTGATATGG + Intergenic
923583841 1:235247675-235247697 TTTTTTAAATGCCTGATTTAAGG - Intronic
1063744719 10:8867463-8867485 TTTAAAAAATGCCTATGTTATGG - Intergenic
1064785182 10:18887246-18887268 ATTTTAAAATGGCTGAGTTCAGG + Intergenic
1064849892 10:19698825-19698847 GTCTTAAAAAGACTGTGGTATGG + Intronic
1066998261 10:42583154-42583176 ATTTGAAAATGTCTGTCTTAGGG + Intronic
1067182417 10:43998678-43998700 TTTTTCAAATGCCAGTGTTGTGG + Intergenic
1068797045 10:61094731-61094753 CTTTTAAAATGACTATGTTCTGG - Intergenic
1068953649 10:62803308-62803330 TTTGTAGAATGCCGGTGTTAAGG - Intergenic
1069115227 10:64496853-64496875 AGTTTAAAATACCTGTGTTGAGG - Intergenic
1071300469 10:84252664-84252686 GTTTTCTTATCCCTGTGTTACGG - Intronic
1071521615 10:86334843-86334865 GATTTAACAGGCCTGTGTTCTGG - Intronic
1071931834 10:90481091-90481113 GTTTTAAAATGCAGGTGTTTGGG + Intergenic
1072191337 10:93079048-93079070 GTTTTAAAATGGCTTTGTGCCGG - Intergenic
1072560160 10:96565230-96565252 TTTATAAAATGACTCTGTTAAGG - Intronic
1073708010 10:106009027-106009049 GTTTTAAAATGATTGTTTTAAGG + Intergenic
1074578406 10:114693028-114693050 GTTTCAGAAAGCCAGTGTTAGGG - Intergenic
1074716869 10:116227946-116227968 ATTTTAAAGTGCCTATGTTTTGG + Intronic
1075764203 10:124879697-124879719 GTTATCAAATGCCTTTGTGATGG - Intergenic
1078113847 11:8425714-8425736 GGTTTAAAATACCTGTTTAAAGG - Intronic
1080109760 11:28553034-28553056 CTTGCAAAATACCTGTGTTATGG + Intergenic
1080331407 11:31144013-31144035 CTTTTAAAATGGTTGTGTTTTGG - Intronic
1080993442 11:37570371-37570393 GTTTTATATTGCTTGTTTTAAGG + Intergenic
1083152435 11:60800494-60800516 CTTATAAAATCCCTGTGTGAAGG + Exonic
1085362553 11:75903681-75903703 TTTTTAAAAAGCCTTTCTTATGG + Intronic
1085567641 11:77529106-77529128 GTTTAAAAATACCTGTCTTGCGG - Intronic
1088125552 11:106419325-106419347 GTTTGAAAATTCCTGTGATTTGG + Intergenic
1089019830 11:115201670-115201692 GTTTTAAAAAGGCTTTGTTAGGG - Intronic
1092078102 12:5690142-5690164 GGTTGAGAATGCCTGTATTAGGG - Intronic
1092806652 12:12229432-12229454 ATTTTTAAATGGCTGAGTTAAGG - Intronic
1093706825 12:22283576-22283598 GTTTTAAAAATCCTGTGTGAAGG + Intronic
1094693558 12:32794029-32794051 GTTTACAAATGCCTGTGATATGG - Intronic
1095237397 12:39813843-39813865 ATTTTAAAATGCCTGTGTAGGGG - Intronic
1095772807 12:45980844-45980866 GTTCCAAAATACCTGTGTTTGGG + Intronic
1096306585 12:50483060-50483082 CTTTTAAAATGCATTTTTTAAGG + Intergenic
1099396932 12:82151710-82151732 ATTTTATGATGCCTGTGCTATGG - Intergenic
1100103535 12:91140355-91140377 TTTTTTAAATCCCTGTGTTTTGG - Intergenic
1100126660 12:91435586-91435608 ATTTTAAAAAACCTGAGTTAAGG + Intergenic
1100286489 12:93171865-93171887 ATATTAAAATTCCTGTGTGATGG - Intergenic
1101126818 12:101643819-101643841 TTTTTAAAATGCCACTGTTTGGG + Intronic
1101492850 12:105225394-105225416 CTTTTAAAATGGATTTGTTAGGG - Intronic
1105486794 13:20841093-20841115 ATTTTAAAGTGTCTGTTTTAAGG - Intronic
1106028266 13:25975259-25975281 CTTTTAAAATGAGTGTTTTAAGG - Intronic
1106949538 13:34867657-34867679 ATTTGAAAGTGCCAGTGTTACGG + Intergenic
1108105201 13:47001436-47001458 GATGTAAAATGACTGTGATACGG - Intergenic
1109656442 13:65397098-65397120 CTTGGAAAATGCCTGTTTTAGGG - Intergenic
1111013796 13:82349241-82349263 GTTTTAAAAATCCAGTGATAAGG + Intergenic
1111401723 13:87745992-87746014 ATTTTAATATTCCTGTGTTCAGG - Intergenic
1111847301 13:93527537-93527559 GCTTTAAAATGTCTGTGTTCAGG - Intronic
1112184321 13:97113559-97113581 TTTTTAAAATGCCAGTTTTCAGG - Intergenic
1112357231 13:98683965-98683987 GGTTTGAAATGGCTGTGATAAGG - Exonic
1113409408 13:110071725-110071747 ATTTTAAATTTCCTGTGTAACGG + Intergenic
1116012259 14:39365515-39365537 ATTTCAAAAGGCCTGTGTTTAGG + Intronic
1116706087 14:48303198-48303220 GTTCTGAAATGTTTGTGTTATGG - Intergenic
1116769518 14:49111028-49111050 ATCTTAAAATGCCTGAGTCATGG + Intergenic
1116822580 14:49639978-49640000 GTTTGGAAATGCCTTTTTTAAGG - Intergenic
1119497866 14:75096371-75096393 CTTTATAAATGCCTGTGTAAGGG - Intronic
1119915536 14:78397912-78397934 CTTTTAAAATGACTGTTTTAGGG + Intronic
1119940717 14:78638331-78638353 CTTTTAAAATACCTGTGTGATGG + Intronic
1120966053 14:90168603-90168625 GGTTTAAAATGCATGTTTTCTGG + Intronic
1121629045 14:95409277-95409299 CTTTCAAAAAGCCTGTGCTATGG - Intronic
1121868513 14:97385470-97385492 GTTTTCAAATACCTTTGTAATGG + Intergenic
1202871029 14_GL000225v1_random:164124-164146 GTTTTCAAATACATGTGTTTAGG - Intergenic
1123912455 15:24981577-24981599 GTTTTTAAATGCATGTTTTCCGG + Intergenic
1126234506 15:46367813-46367835 GTTTGAAGATGCCTGTTTGAAGG + Intergenic
1127922087 15:63502464-63502486 GTTTTTAAAAGCCGGTGTTGGGG + Intergenic
1129065022 15:72895276-72895298 GTTTTGAAATTACTGTTTTATGG + Intergenic
1133491019 16:6268111-6268133 GTTTTAAAATGCATGAGTTGAGG + Intronic
1134487713 16:14671548-14671570 CATTTAAAATGTCTGTGTTAGGG - Intergenic
1135867247 16:26115025-26115047 CTTTTAAAATGAATGTTTTATGG - Intronic
1136925560 16:34369948-34369970 GTTTGAGAATGACTGAGTTAGGG + Intergenic
1136979014 16:35041858-35041880 GTTTGAGAATGACTGAGTTAGGG - Intergenic
1137735123 16:50718156-50718178 GTGGTAAAATGCCTGTGTGATGG + Intronic
1137791714 16:51180556-51180578 GTTTGAGAATTGCTGTGTTACGG + Intergenic
1138290309 16:55841082-55841104 GTTTTTAAATGTTTGTGTAAAGG + Intergenic
1140464533 16:75169608-75169630 GTTTAAAAATGGCTGCTTTATGG - Exonic
1141771170 16:86090427-86090449 GTTCTAAAATGCCTTTGCTCTGG - Intergenic
1143768953 17:9155748-9155770 GTTTGAGAATTCCTGGGTTAGGG - Intronic
1143945094 17:10584205-10584227 TTTTAAAAATGCCTGTGGCAAGG + Intergenic
1144127807 17:12219166-12219188 GTTTTAAAATGCCAGTTTCTTGG + Intergenic
1144374033 17:14621251-14621273 GTTGCAACATCCCTGTGTTATGG + Intergenic
1145923391 17:28628177-28628199 GTTTTAAAAGGACTGAGTCATGG - Intronic
1146191862 17:30775628-30775650 GTGTTACAATGCTTGTCTTAGGG - Intronic
1146974932 17:37103010-37103032 GTTTTTAAATGCCCATGTGAAGG + Intronic
1149458115 17:56805919-56805941 TTTTTTAAATGCCTGTCTTTGGG + Intronic
1149489748 17:57075327-57075349 GTTTTATTCTGCTTGTGTTAGGG - Intergenic
1150207278 17:63418673-63418695 GTTGAAAAATGCCTGAGATACGG - Intronic
1151198708 17:72451944-72451966 TTTTTAAAAAGCTAGTGTTATGG + Intergenic
1153149472 18:2074249-2074271 ATATTAAAATGCATGTTTTAGGG + Intergenic
1153680078 18:7492237-7492259 ACTTTAAAATGCCTGTTTGAGGG + Intergenic
1154159520 18:11970908-11970930 CTTTTAAAATGACTGTTTTCAGG - Intergenic
1155294660 18:24374178-24374200 ATTTTAAAATATCTTTGTTATGG - Intronic
1157024799 18:43829956-43829978 GATTAAAAATCGCTGTGTTAAGG + Intergenic
1157463096 18:47919236-47919258 GTCTGAAAATGCCTTTGTTCTGG - Intronic
1157859059 18:51124719-51124741 GTTTTAAAATGCAGGTTTTCTGG + Intergenic
1160118534 18:76105659-76105681 CTTTAAAAAACCCTGTGTTAAGG + Intergenic
1160476615 18:79195583-79195605 GTTTTTAAATGTCTGATTTATGG - Intronic
1162051328 19:8035536-8035558 GATTTAAAAGGCCTGTGTAGCGG - Intronic
1163482243 19:17563861-17563883 GTTTTAAAATGATTGTTTGAAGG + Intronic
1164948014 19:32312347-32312369 GTTCTCAACTGCCTGTGTGATGG - Intergenic
1164965950 19:32483970-32483992 GTTTTCAAAATCCTCTGTTATGG + Exonic
925876550 2:8316233-8316255 GCTTTTAAATGCCTGTTTTGGGG + Intergenic
928936485 2:36684170-36684192 TGTTTATAATACCTGTGTTATGG - Intergenic
929717717 2:44330294-44330316 GTACTAAAATGCCTGTGGAAAGG + Intronic
930313007 2:49765617-49765639 GGGTTAAAATCCATGTGTTAGGG - Intergenic
930721839 2:54645676-54645698 CTTTTAAAAAGTCTGTTTTAGGG - Intronic
931022820 2:58069204-58069226 GTTTTAACAGGTCTGTGTTTGGG + Intronic
931960815 2:67480431-67480453 GCTTTAAAATGCTTGAGTTAGGG + Intergenic
933276326 2:80288181-80288203 GGTTTTCAATCCCTGTGTTAAGG - Intronic
934488909 2:94744400-94744422 GTTTTAATTTGCTTATGTTAGGG + Intergenic
935096576 2:99950047-99950069 GTTTTAGAATTCCTTTGTTGTGG - Intronic
938325050 2:130392783-130392805 GTTTTAAAACACCCGTGTCAGGG + Intergenic
939904633 2:147896790-147896812 CTTTTAAAATGCCAGTTTTAAGG + Intronic
942483281 2:176412822-176412844 GCTTTCATATGCATGTGTTATGG + Intergenic
943000138 2:182316999-182317021 GGTTTAAAAGGCTTGTGTTTTGG + Intronic
943058698 2:183015226-183015248 GTTTTAAAATAGATGTGTTTTGG + Intronic
943654302 2:190491209-190491231 TTTTTAAAATACTTGTGTTCTGG + Intronic
943772547 2:191733982-191734004 GGTTTCAAATGTCTCTGTTACGG - Intergenic
944224545 2:197337125-197337147 TTTCTAAAATGCAGGTGTTAGGG + Intergenic
944251027 2:197580308-197580330 GTTTTGAAATTCCTGTGTGCTGG - Intronic
944535233 2:200702965-200702987 GTTTTAACATGACTGTGATTTGG - Intergenic
945030387 2:205657765-205657787 GTTTCAAAATGCCTTTGGTAAGG - Intergenic
945246382 2:207721094-207721116 GGTTTGAAATGTTTGTGTTATGG + Intronic
945384236 2:209178283-209178305 GTTTTTATATGTCTCTGTTATGG + Intergenic
947753037 2:232542644-232542666 GTTTTAAAAAGCATATTTTATGG - Intronic
1169008430 20:2229195-2229217 GTTTTGTAATGCCTGTGACAAGG - Intergenic
1169159361 20:3363296-3363318 GTTTTAAAATGTCTTTATTCTGG + Intronic
1169159387 20:3363550-3363572 GTTTTAAAATGTCTTTATTCTGG + Intronic
1171825206 20:29893565-29893587 GTTTTGAAATCCCCGTTTTATGG + Intergenic
1173047267 20:39524597-39524619 GTTTTTAAATGTCTGTATAAGGG - Intergenic
1173304291 20:41833328-41833350 GTTTTATAATGCATATATTATGG + Intergenic
1175582588 20:60112105-60112127 TATTTAAAATGCCTGTTTTCAGG - Intergenic
1177919662 21:27135561-27135583 TTTTTAAAATGCTTGTTTTAAGG + Intergenic
1181095876 22:20504941-20504963 GTTTTGAAAGTCCTGTGTTCTGG - Intronic
1184946897 22:47810228-47810250 GTGTTTATATGCCTGTGTTAAGG + Intergenic
949920401 3:8995641-8995663 GTTTTAAACTGCATGGTTTAAGG + Intronic
951511820 3:23510770-23510792 TTTTTTAAATACCTGTTTTAAGG + Intronic
951516377 3:23564531-23564553 ATTTTAAAATGCTTGTGTGGTGG - Intronic
952174168 3:30843568-30843590 TTTTTAAAATGCAGGTGTTAAGG + Intronic
953773113 3:45793827-45793849 GTTGTAAACTGCCTGGGTTTGGG + Intronic
955798703 3:62664304-62664326 GTTTAAAAATGGTTGTGTTGGGG - Intronic
955822751 3:62913645-62913667 GTGTTAAAGTGCTTGTGTTCAGG - Intergenic
957922519 3:86763833-86763855 ATTTTGAAATGTCTGTGTTTGGG - Intergenic
958455082 3:94320617-94320639 GTTTAAAAATGCCTTGGTAAAGG + Intergenic
958517891 3:95143828-95143850 GTATTTAAATGGCTGTTTTAAGG + Intergenic
959047797 3:101493524-101493546 GTTTTAAAATGTATGTTTTAAGG - Intronic
959836990 3:110930526-110930548 TTTTTAAAATACTTGTGTTTAGG - Intergenic
960724305 3:120654770-120654792 ATGTTAAAATACCTGTGGTAAGG + Intronic
963098068 3:141567079-141567101 GTTTTATAAATCCTGTGCTAAGG - Intronic
963409897 3:144913751-144913773 TTTTTATAATGCCTACGTTAAGG - Intergenic
964231864 3:154479733-154479755 TTTTTTAAATGCCAGTGTCAAGG + Intergenic
966070035 3:175864772-175864794 GATTTAAAAGATCTGTGTTATGG - Intergenic
967515846 3:190367622-190367644 GTTTTTAAATGGCTTTATTATGG + Intronic
969718691 4:8881165-8881187 GTTTTCATATGTGTGTGTTAAGG - Intergenic
970276967 4:14411971-14411993 CTTTAAAAATGCTTGTGATAAGG - Intergenic
970726816 4:19055956-19055978 GTTTTAAAATGCCAGTTCTATGG - Intergenic
970926312 4:21456607-21456629 ATTTTAAAATGCATGTCTTAAGG + Intronic
971646340 4:29209465-29209487 GTTTTCAAATGCATTTTTTAGGG + Intergenic
972601602 4:40577731-40577753 GTTTTAAACGGTCTGTGATAAGG - Intronic
972915155 4:43868060-43868082 CTTTTAAAATGCATGTGATAAGG + Intergenic
972968259 4:44539585-44539607 GTTTTATAATCCCTGTTTTCCGG + Intergenic
974738133 4:65967369-65967391 GTTTTAAAATGCATGTACAATGG + Intergenic
974897359 4:67955503-67955525 GTATTCAAATGCCTGTGTCAGGG + Intronic
975551467 4:75617234-75617256 ATTGTAAAATGTCTGTTTTAAGG - Intronic
975897347 4:79108546-79108568 CTTTTAAAATTCCTGCATTAAGG - Intergenic
976033868 4:80793031-80793053 ATTTTAAAGTACATGTGTTAGGG + Intronic
976361890 4:84189360-84189382 GTTTTTATATGCCTGTAGTAAGG + Intergenic
977428115 4:96895264-96895286 GAATTAAAATGCCTATATTAGGG + Intergenic
977861209 4:101962338-101962360 ATTTGACAATGCCTGTGTTTAGG - Intronic
978346873 4:107779800-107779822 TTTTTAAAATGCCTATGCTCAGG - Intergenic
979149621 4:117293706-117293728 GTTTAAAAATGCATGTGTGCTGG + Intergenic
979624384 4:122828422-122828444 GTTTTAAAAGCTGTGTGTTATGG + Intronic
980219037 4:129891431-129891453 GTTTTAAAATAGCTGTGCCATGG + Intergenic
980968426 4:139546236-139546258 TTTTTTAAATGCCTGTCTTTGGG - Intronic
981576985 4:146215708-146215730 CTTCTAAAATGCCTGTGTGCAGG + Intergenic
982469316 4:155768130-155768152 TTTTCAACATGCCTGTGTTCAGG + Intronic
982946089 4:161625574-161625596 GTTTTAAAATTTGTGTCTTAGGG - Intronic
983418299 4:167485435-167485457 TTTTTAAAAGCCCTGTGTCAGGG + Intergenic
983699152 4:170570047-170570069 GTATCAAAATGCCTCTGTAAAGG - Intergenic
984154775 4:176182171-176182193 GTTTAAATATGCCTCTGTAAAGG + Intronic
984330143 4:178303863-178303885 ATTATACAATGCCTGTATTAGGG - Intergenic
984371768 4:178876057-178876079 GTTTTACAATGACTGTCTGATGG - Intergenic
985190198 4:187364644-187364666 CTTTTAAAATGTCAGTGTCATGG + Intergenic
986556057 5:9010679-9010701 CTTTAAAAATGCCTGTGCCAAGG + Intergenic
988242423 5:28631530-28631552 GTTTGAAAATGCCTTAATTAAGG + Intergenic
993112903 5:83681295-83681317 GCTTTAAAATGCCTCCGTTTAGG - Intronic
993824829 5:92670092-92670114 GTTTTAAACTTCCTATTTTAAGG + Intergenic
993995765 5:94720579-94720601 GGTTTAAAATGCCTATGTTGGGG + Intronic
994550257 5:101225523-101225545 TTGTTAGAATGACTGTGTTATGG + Intergenic
994800658 5:104369894-104369916 GATTTAAAATTCCTGTGGCACGG - Intergenic
997734054 5:136200587-136200609 GTTTTAAAATGCCACTTTAAAGG - Intergenic
998037401 5:138928599-138928621 GTCTTAAAATGCCGGTGTTGGGG + Intronic
999650127 5:153757023-153757045 GATTCAAAATAGCTGTGTTAAGG + Intronic
999933495 5:156459354-156459376 GTTTGAAAAGTCCTGTTTTAAGG - Intronic
1002404061 5:179015224-179015246 GTTTTATATTGCCTAGGTTAAGG + Intergenic
1003300804 6:4880876-4880898 GTTTTAAGATACCTTTGTTTTGG + Intronic
1004019493 6:11763868-11763890 GTTTGGGAATGACTGTGTTAGGG + Intronic
1005007664 6:21305873-21305895 TTTTAAAAATACCTGTATTAAGG - Intergenic
1005270866 6:24161810-24161832 ACTTTAAAAAACCTGTGTTAAGG - Intergenic
1010822090 6:80427252-80427274 GTTTTTTAATGGCTGTTTTAAGG + Intergenic
1010950506 6:82031512-82031534 GTTTTAAAATTCCTGTGACTTGG - Intergenic
1010992117 6:82490916-82490938 TTTTAAAAATTCCTGTGTTAAGG - Intergenic
1011883683 6:92063816-92063838 GTTTTAAAATGACTTTGCCAGGG - Intergenic
1012003762 6:93686154-93686176 GATTTAAAATAGCTGTTTTAAGG + Intergenic
1012197484 6:96361984-96362006 GTGTTAACTTGCCTGGGTTAAGG + Intergenic
1012457991 6:99428379-99428401 GTTTTAAGATGGATGTGATATGG - Intergenic
1012579932 6:100854997-100855019 CTTTTAAAATGCCTCTACTAAGG + Intronic
1012975446 6:105776779-105776801 GTTTTAAAACAGCTGTGTTAGGG - Intergenic
1013079101 6:106796944-106796966 GTTTTCCCATGCCTGAGTTAGGG - Intergenic
1013390992 6:109686316-109686338 GTTTTAAAAGGCCAGTGGTCTGG + Intronic
1013685161 6:112572531-112572553 GTTTTAAAAAGACTTTGTGATGG + Intergenic
1013796898 6:113898460-113898482 GTCTTAGAATGACAGTGTTATGG + Intergenic
1014052712 6:116974518-116974540 GTTTTAAAATGTATGTGTAGGGG - Intergenic
1014425318 6:121297336-121297358 TTTTTAAAATTTCTGTCTTAGGG - Intronic
1016024514 6:139272422-139272444 GGTTTAAAATGCTTATTTTAGGG - Intronic
1018026395 6:159809708-159809730 GTACTGAAATTCCTGTGTTACGG - Intronic
1019833894 7:3361261-3361283 GTTTTAAAATGAATTTTTTAAGG - Intronic
1022331397 7:29382698-29382720 TTTATAAAAGGCCTGAGTTAGGG - Intronic
1022607250 7:31827743-31827765 TTTTTAAAATGCATATATTATGG + Intronic
1023775745 7:43605095-43605117 TCTTTATAATGCCTGTTTTAAGG + Intronic
1024986763 7:55200801-55200823 GTTTTGGTATTCCTGTGTTATGG - Intronic
1028440437 7:90853583-90853605 GTTTAAAAATCACTGTGCTATGG - Intronic
1029520203 7:101056003-101056025 GCCTTAATATGCCTGTATTAGGG + Intronic
1029715164 7:102321683-102321705 GTTATTAAAAGCCTGTTTTAGGG + Exonic
1029941046 7:104481084-104481106 GTGTAGAAATGTCTGTGTTAGGG - Intronic
1030470148 7:109953370-109953392 TTTTTAAAATGGCTGTTTTAGGG + Intergenic
1032807845 7:135375622-135375644 TTTTTAAAAGGCGTGTGTTAGGG + Intronic
1032808766 7:135386302-135386324 GGTTAAAAATTCCTATGTTAAGG + Intronic
1033765900 7:144489964-144489986 TTTTTAAAAGTCCTTTGTTAAGG + Intronic
1034967623 7:155401024-155401046 TTTTTAAAAAGCCTGTGTGCTGG + Intergenic
1035842376 8:2826691-2826713 GTTTTAAAATTTCTGTATTGTGG - Intergenic
1037101734 8:15055230-15055252 GTATTAAAATATCTGTTTTATGG - Intronic
1037265347 8:17053238-17053260 GTTTTAAATTGCCTCTTTTAGGG + Intronic
1038668766 8:29564397-29564419 CCTTTTAAATGCATGTGTTAGGG + Intergenic
1039273157 8:35905376-35905398 GTTTCAAAATGGCTGTGATTTGG + Intergenic
1039434857 8:37553137-37553159 GTTATAAAATGGGTGTTTTATGG - Intergenic
1042496855 8:69464539-69464561 GTTCTGAAATGCTTTTGTTAGGG - Intergenic
1043371356 8:79597384-79597406 GTTATAAAATGAATGTGTTCTGG - Intergenic
1045491092 8:102670010-102670032 GTTTCAAAGTGCTTGTGTAATGG + Intergenic
1046003117 8:108444900-108444922 GTTTTAAAAGGCTTGTGTCAGGG + Intronic
1046619751 8:116516280-116516302 GCTTCTAAATGCCTGTGTTGGGG - Intergenic
1046796543 8:118379802-118379824 ATTCTAAAATGTCTGTGTTTAGG - Intronic
1048049261 8:130802035-130802057 GTTTCTAAATTCCTGTGTTAAGG + Intronic
1048225610 8:132582235-132582257 CATGTAAAATGCCTGTGTGAAGG - Intronic
1050419373 9:5447340-5447362 GTTTTAAAGTACCTGTGGCATGG + Intergenic
1051081167 9:13295566-13295588 GCTTTAAACTGCCTGATTTAGGG - Intergenic
1051414668 9:16826391-16826413 GTTGTGAAATGTTTGTGTTAAGG - Intronic
1051579418 9:18654663-18654685 ATTTTAAAATGCTTTTGTTTGGG - Intronic
1051841391 9:21402419-21402441 GTTTTAACATACCTGAATTATGG + Intergenic
1053414408 9:37937985-37938007 GTGGTAAAATCCCAGTGTTAAGG - Intronic
1055963021 9:81838438-81838460 CTTTTAAAATGCCTTTGGTGAGG - Intergenic
1057240831 9:93407038-93407060 GTTATAAAGTACTTGTGTTAGGG - Intergenic
1059599587 9:115762249-115762271 ATTTTAGAAAGCCTGAGTTATGG + Intergenic
1060497977 9:124131902-124131924 CTTTTAAAATTACTGTGTAATGG + Intergenic
1060957640 9:127654676-127654698 GTTTTAAAATGCAGATGTAAGGG + Intronic
1188048781 X:25459027-25459049 GTTTTTAAATGACAGTGATAAGG - Intergenic
1188387548 X:29579592-29579614 GTTTTAAAATTCATTAGTTAAGG + Intronic
1190093214 X:47457881-47457903 GTTTTAAAGAGCCTGAATTATGG + Intronic
1190322788 X:49188336-49188358 GTTTTACAATGGCTGGGTTTGGG - Exonic
1193212384 X:78822376-78822398 ATTTCAAAATGCTTGTGTTTTGG + Intergenic
1193712285 X:84894298-84894320 GTTTTCAAATGGCTGTCTTCTGG + Intergenic
1194016106 X:88623712-88623734 GTTTTAAAATGTCTGATTAATGG - Intergenic
1194717920 X:97308479-97308501 GTGTTAAAAAGCCTCTGCTAAGG + Intronic
1195269904 X:103219409-103219431 CTTTAAAAAGGCCAGTGTTATGG + Intergenic
1195943523 X:110185076-110185098 GTTTTAAAATAATTGTTTTATGG - Intergenic
1196567016 X:117219834-117219856 GTTTTAGAATTCCTGCTTTAAGG - Intergenic
1196572002 X:117276959-117276981 GTTTGAAAATGCCTGTATATTGG - Intergenic
1197339900 X:125254776-125254798 GTTTTAAAATGCAGGTGTTGTGG - Intergenic
1199394999 X:147325722-147325744 ATTTTAAAATGCCATTGATATGG + Intergenic
1200360283 X:155598126-155598148 ATTTTAAAATTCCTGTGGCATGG - Intronic