ID: 910343299

View in Genome Browser
Species Human (GRCh38)
Location 1:86212010-86212032
Sequence CTATGTGCCTGCCATGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910343299_910343302 9 Left 910343299 1:86212010-86212032 CCAGCATCATGGCAGGCACATAG No data
Right 910343302 1:86212042-86212064 CAGAGATGAAGCAGGAGACCTGG No data
910343299_910343301 1 Left 910343299 1:86212010-86212032 CCAGCATCATGGCAGGCACATAG No data
Right 910343301 1:86212034-86212056 AAAGTAAACAGAGATGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910343299 Original CRISPR CTATGTGCCTGCCATGATGC TGG (reversed) Intergenic
No off target data available for this crispr