ID: 910348626

View in Genome Browser
Species Human (GRCh38)
Location 1:86270184-86270206
Sequence GGCTGCACAAAGAATCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910348626_910348630 27 Left 910348626 1:86270184-86270206 CCCAGGTGATTCTTTGTGCAGCC No data
Right 910348630 1:86270234-86270256 TCTTTTCAAAGTGTGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910348626 Original CRISPR GGCTGCACAAAGAATCACCT GGG (reversed) Intergenic
No off target data available for this crispr