ID: 910354266

View in Genome Browser
Species Human (GRCh38)
Location 1:86337516-86337538
Sequence TTGAATAAGTACATGTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910354266_910354269 6 Left 910354266 1:86337516-86337538 CCCATATACATGTACTTATTCAA No data
Right 910354269 1:86337545-86337567 ATTTGTATTAAAATTATCTTAGG No data
910354266_910354270 28 Left 910354266 1:86337516-86337538 CCCATATACATGTACTTATTCAA No data
Right 910354270 1:86337567-86337589 GTTGCTAAAAATCAACAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910354266 Original CRISPR TTGAATAAGTACATGTATAT GGG (reversed) Intergenic
No off target data available for this crispr