ID: 910354270

View in Genome Browser
Species Human (GRCh38)
Location 1:86337567-86337589
Sequence GTTGCTAAAAATCAACAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910354268_910354270 1 Left 910354268 1:86337543-86337565 CCATTTGTATTAAAATTATCTTA No data
Right 910354270 1:86337567-86337589 GTTGCTAAAAATCAACAGTTAGG No data
910354266_910354270 28 Left 910354266 1:86337516-86337538 CCCATATACATGTACTTATTCAA No data
Right 910354270 1:86337567-86337589 GTTGCTAAAAATCAACAGTTAGG No data
910354267_910354270 27 Left 910354267 1:86337517-86337539 CCATATACATGTACTTATTCAAT No data
Right 910354270 1:86337567-86337589 GTTGCTAAAAATCAACAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910354270 Original CRISPR GTTGCTAAAAATCAACAGTT AGG Intergenic
No off target data available for this crispr