ID: 910359725

View in Genome Browser
Species Human (GRCh38)
Location 1:86403675-86403697
Sequence GAGAGCCACCACTGAAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910359723_910359725 14 Left 910359723 1:86403638-86403660 CCAGATATACTTGGAGTCAGCCA No data
Right 910359725 1:86403675-86403697 GAGAGCCACCACTGAAAAGTTGG No data
910359724_910359725 -6 Left 910359724 1:86403658-86403680 CCAAGTCTGAGAGCTCTGAGAGC No data
Right 910359725 1:86403675-86403697 GAGAGCCACCACTGAAAAGTTGG No data
910359722_910359725 17 Left 910359722 1:86403635-86403657 CCACCAGATATACTTGGAGTCAG No data
Right 910359725 1:86403675-86403697 GAGAGCCACCACTGAAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910359725 Original CRISPR GAGAGCCACCACTGAAAAGT TGG Intergenic
No off target data available for this crispr