ID: 910359830

View in Genome Browser
Species Human (GRCh38)
Location 1:86404531-86404553
Sequence ATTTCTAGGCTGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 314}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910359823_910359830 8 Left 910359823 1:86404500-86404522 CCAGGTCACGTAATGTTCCACTA 0: 1
1: 0
2: 8
3: 10
4: 30
Right 910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 314
910359822_910359830 9 Left 910359822 1:86404499-86404521 CCCAGGTCACGTAATGTTCCACT 0: 1
1: 0
2: 8
3: 13
4: 44
Right 910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 314
910359821_910359830 10 Left 910359821 1:86404498-86404520 CCCCAGGTCACGTAATGTTCCAC 0: 1
1: 0
2: 12
3: 11
4: 44
Right 910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 314
910359824_910359830 -9 Left 910359824 1:86404517-86404539 CCACTATATGCAGCATTTCTAGG 0: 1
1: 2
2: 8
3: 12
4: 96
Right 910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910359830 Original CRISPR ATTTCTAGGCTGAGGGTGGA GGG Intergenic
900361458 1:2291068-2291090 AGTTCTGGGGTGAGGGTGAACGG - Intronic
901068106 1:6504221-6504243 AGTGCCCGGCTGAGGGTGGAGGG + Intronic
902579258 1:17398091-17398113 ATTTCTTGGCTGAGGTTGCATGG + Intronic
903010402 1:20325895-20325917 AAATCTAGGCTCAGGGAGGAGGG + Intronic
903491336 1:23731005-23731027 ATTTATAGGCAGAGGTTGGTGGG - Intergenic
903861482 1:26367420-26367442 AGTTCTGGCCTGAGGGTGCAGGG - Intronic
904794342 1:33047797-33047819 ATTTCTAGGCAGAAGGTTTAAGG - Intronic
906154643 1:43606746-43606768 ATTAATAGGCAGAGGGTGGGGGG + Intronic
907440577 1:54475825-54475847 CTTACTAGGGTGAGGGTGGGTGG - Intergenic
907644817 1:56231747-56231769 TTACCTAGCCTGAGGGTGGAAGG + Intergenic
908164358 1:61443420-61443442 ATTGCATGGCTGGGGGTGGATGG - Intronic
909136071 1:71802117-71802139 ATTTCTAAGCTAAGTGTTGAAGG + Intronic
910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG + Intergenic
911388209 1:97204523-97204545 AGTTCTAGGCTGAGGGTTTTAGG + Intronic
911678935 1:100691919-100691941 ATTTCCAGGCTGTGGGTGAACGG + Intergenic
912278840 1:108291048-108291070 ATTTCTAGGCAAAGTGTTGAAGG - Intergenic
912289386 1:108403309-108403331 ATTTCTAGGCAAAGTGTTGAAGG + Intronic
912382962 1:109257481-109257503 ATTTCTGGGCTTAGGGTGTGTGG + Intronic
913195847 1:116455344-116455366 ATCTGTATGCTGAGGGTGGGCGG - Intergenic
915301790 1:154955945-154955967 ATTTCTGGGCTGGGGGAGGAAGG - Intronic
915594752 1:156890084-156890106 ATTTCATGCCTGAGTGTGGAAGG + Intergenic
915630860 1:157153478-157153500 ATTTGAAGGCTGAGGAAGGAAGG - Intergenic
920141108 1:203814118-203814140 ATTTCTAAGCAAAGTGTGGAAGG - Intronic
921664050 1:217845367-217845389 CTTTCTAGGCTCCAGGTGGAAGG + Intronic
922201991 1:223411797-223411819 ATTTCTGAGCTGAGGCTGTAAGG - Intergenic
924262803 1:242249278-242249300 ATTTCATGGCAGAAGGTGGAAGG - Intronic
1064554059 10:16530664-16530686 AGTTCAGGGCTCAGGGTGGAGGG - Intergenic
1065314636 10:24451345-24451367 ATGTTAAGGCTGAAGGTGGAGGG + Intronic
1066725435 10:38387652-38387674 ATTTCATGGCAGAAGGTGGAAGG + Intergenic
1066754814 10:38700571-38700593 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1067066460 10:43106696-43106718 AGTGCTGGGCAGAGGGTGGAGGG - Intronic
1067707135 10:48615229-48615251 ATTTCTGGGCTGAGTCTTGAAGG + Intronic
1069628225 10:69881149-69881171 ATATCGAGGCTGTGGGAGGAAGG + Intronic
1070812730 10:79306411-79306433 ATTTCTGTGCTGATGGTGGCAGG + Intronic
1072417989 10:95264778-95264800 AAGTCTAGGGTGGGGGTGGAGGG - Intronic
1072905479 10:99449339-99449361 AAGTCTAGGCAGAAGGTGGAAGG + Intergenic
1073214381 10:101828569-101828591 TTCTCTAGGCTGAGGGAGGGAGG - Intronic
1073704753 10:105970565-105970587 ATTTCTGGGCTGAGGCTTGAAGG - Intergenic
1074319376 10:112387503-112387525 TTTCCTAGGTTGAGGGTGGCAGG + Intronic
1074889383 10:117722542-117722564 ATTTGTTGGCTGAAGGTAGAAGG + Intergenic
1075350460 10:121720103-121720125 GTTAATGGGCTGAGGGTGGAAGG - Intergenic
1075372965 10:121953471-121953493 ATTTCTGTGCTGAGGGTGGTAGG - Intergenic
1075378281 10:121997286-121997308 CATTCTGGTCTGAGGGTGGATGG + Intronic
1075630472 10:123997813-123997835 GTGTCCAGCCTGAGGGTGGAGGG - Intergenic
1076405306 10:130208214-130208236 GTTTCTGGGCTGGGGGTGCACGG + Intergenic
1076704562 10:132294055-132294077 ATGTCGAGTCGGAGGGTGGACGG + Intronic
1076742701 10:132494930-132494952 ATTATTAAGCTGAGGGAGGAAGG + Intergenic
1076853313 10:133103517-133103539 ATTCCCAGCCTGAGGATGGATGG - Intronic
1077017688 11:404222-404244 CTGTCGGGGCTGAGGGTGGAGGG - Exonic
1077643866 11:3905934-3905956 ATATCTGGGATGAGGGAGGAGGG + Intronic
1077700028 11:4432525-4432547 ATGTCCAGGCTGTGGGTGGTGGG + Intergenic
1078397550 11:10994615-10994637 ATTTCCAGGCAGAGTGTTGAAGG - Intergenic
1078531936 11:12143285-12143307 TTTTCTTAGCTGAGGGTGCAAGG + Intronic
1078731587 11:13979874-13979896 CTCTCTAGGGTGAGGGTGGGTGG - Intronic
1082139435 11:48590874-48590896 ATATCCAGACTGAGTGTGGATGG + Intergenic
1082618300 11:55389628-55389650 ATATCCAGACTGAGTGTGGATGG + Intergenic
1082622911 11:55445845-55445867 ATATCTAGAATGAGTGTGGATGG + Intergenic
1082624617 11:55467877-55467899 ATATCCAGACTGAGAGTGGATGG + Intergenic
1082625469 11:55479027-55479049 ACATCTAGACTGAGTGTGGATGG + Intergenic
1084095144 11:66906484-66906506 AGTTCTAGGCCAGGGGTGGAGGG - Intronic
1084133075 11:67152372-67152394 TTTGCGAGGCTGAGGTTGGAGGG + Intronic
1086223857 11:84483658-84483680 ATCTGTAGGAAGAGGGTGGATGG + Intronic
1086437881 11:86800089-86800111 AGTTCTAGGCTGTTGGGGGAGGG + Intronic
1087145361 11:94805421-94805443 ATTCCTAGGGTGAGGGTTGTGGG + Intronic
1088916999 11:114235037-114235059 ATTTGGGGGCTGGGGGTGGAGGG + Intronic
1089133497 11:116231004-116231026 AGTCCTTAGCTGAGGGTGGAGGG - Intergenic
1089627040 11:119757837-119757859 ATTTCTAGCATGTGGGTGCATGG - Intergenic
1089902548 11:122002630-122002652 ATTATCAGGCTGGGGGTGGAGGG + Intergenic
1090282039 11:125464761-125464783 ATATCTAGGTTGAGTGCGGATGG - Intronic
1090409906 11:126501014-126501036 ATGTCTCGGCAGCGGGTGGAGGG - Intronic
1091922682 12:4318461-4318483 ATTTTCAGGATGAGAGTGGAGGG - Intergenic
1092058829 12:5531422-5531444 AATTCCAGCCAGAGGGTGGAGGG + Intergenic
1093414703 12:18906972-18906994 AGTATTAGGCTCAGGGTGGAGGG - Intergenic
1094134779 12:27113239-27113261 AAATCCAGGCTGAGGCTGGAGGG + Intergenic
1095727474 12:45469373-45469395 ATTCCTAGGCGGAAGGGGGAAGG + Intergenic
1096237930 12:49942494-49942516 ATGCCCAGGCTGAGGGTGGAGGG - Intergenic
1096648760 12:53051841-53051863 TTTCCTAGGCTGAAGGTGGAGGG - Exonic
1096737145 12:53664477-53664499 CTCTTTTGGCTGAGGGTGGATGG + Intronic
1097278984 12:57832877-57832899 ATTTCTATGCTGAAATTGGAGGG + Intronic
1098096676 12:66964441-66964463 AATTCTAGGGTGTGGGTGAATGG - Intergenic
1099778386 12:87163559-87163581 ATTTCTAAGCAGAGTGTTGAAGG - Intergenic
1100114743 12:91290874-91290896 ATTTGAAGGTGGAGGGTGGAAGG - Intergenic
1103310889 12:120006908-120006930 ATTATCGGGCTGAGGGTGGAGGG + Intronic
1105742730 13:23345369-23345391 ACTGCTAGGCTGGAGGTGGAGGG - Intronic
1107095777 13:36533547-36533569 ATCTCTATGCTGAGAGAGGAAGG + Intergenic
1108082058 13:46747036-46747058 ATTACTTTGCTGAGGTTGGAGGG - Intronic
1109030657 13:57183880-57183902 CTTTCTAGCCTGAGGGTCAAAGG + Intergenic
1109571088 13:64191317-64191339 TTTGGGAGGCTGAGGGTGGAGGG + Intergenic
1109915838 13:68983992-68984014 ATTTCTAGGCTGATAGGGGTGGG - Intergenic
1110053932 13:70940834-70940856 CTTTGAAGGCTGAGGGTGGGAGG + Intergenic
1110596787 13:77328248-77328270 AATTCTAGTTTTAGGGTGGAAGG + Intergenic
1111643461 13:91000389-91000411 AGTTCCAGGCTCAGGTTGGATGG + Intergenic
1111845959 13:93508770-93508792 TTTTCTAGGGAAAGGGTGGAGGG + Intronic
1111982657 13:95033367-95033389 TGTTCTTGGCTTAGGGTGGAAGG - Intronic
1113344495 13:109462758-109462780 ATTCCTAGTATGAGGGTGAAAGG - Intergenic
1113446222 13:110369705-110369727 ATTTGTAAGCTGAGGCGGGAAGG - Intronic
1114199811 14:20509554-20509576 ACTCCTAAGCTGAGGCTGGAGGG - Intronic
1114271344 14:21102171-21102193 CTTCCTAGGCTGAGGGTTGTAGG - Intronic
1114574602 14:23700662-23700684 ATCTCTAGGCAGAGTGTTGAGGG + Intergenic
1114725160 14:24928780-24928802 ATTTATATTCTGAGGGTGCATGG - Intronic
1116081592 14:40180671-40180693 ATTCCCAGGCTGAGGGCAGAAGG + Intergenic
1116727317 14:48576575-48576597 ATTTATAGACAGTGGGTGGAAGG - Intergenic
1117160510 14:52984908-52984930 ATTTCCAGGTTGAAGGAGGAAGG + Intergenic
1117419937 14:55534302-55534324 ATTTTTAGGCTGGGGGTTCAAGG + Intergenic
1117639798 14:57786033-57786055 ATTTCCAGGCAGAGGGTGAGGGG - Intronic
1120666075 14:87308246-87308268 ATTTCTATGGTGGGGGTGGGGGG + Intergenic
1120734353 14:88036632-88036654 ATTTCAGTGCTGAGGGTGAATGG + Intergenic
1123205542 14:106709296-106709318 ATTTCTAAGCAAAGTGTGGATGG + Intergenic
1123482651 15:20647141-20647163 ATTTCTAAGCAAAGTGTGGATGG + Intergenic
1126321912 15:47434191-47434213 ATTTGGAGGCTGAGGGAGAAAGG + Intronic
1126815092 15:52446628-52446650 TTTTCTAGGCTGAAGGTGCAAGG - Intronic
1126869191 15:52969504-52969526 GTTTCTTGGCTGTGGTTGGAGGG + Intergenic
1127249847 15:57221569-57221591 ATTTCCAGGCTTATGGTAGATGG + Intronic
1127480621 15:59373524-59373546 ATGTGTTGGCTGAGGTTGGATGG - Intronic
1128060983 15:64735944-64735966 AATGCTAGGCTGAGGCTAGATGG + Intergenic
1128880490 15:71237766-71237788 ATTTCCAGGGTGAGTGTGTAGGG + Intronic
1131254741 15:90854727-90854749 ATTTCTTGGCTGAGCTTGGAAGG - Intergenic
1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG + Intronic
1136727874 16:32376267-32376289 CTTTCCAGGCTGAGGTTGCATGG - Intergenic
1136779875 16:32891194-32891216 ATTTCTATGCAAAGTGTGGATGG - Intergenic
1136890740 16:33970323-33970345 ATTTCTATGCAAAGTGTGGATGG + Intergenic
1137857338 16:51808023-51808045 ATTTCTAAGCTAAGTGTTGAAGG - Intergenic
1137966141 16:52935706-52935728 ATTTCTGGGGTGGGGGCGGAAGG - Intergenic
1138203196 16:55105297-55105319 ATCCGTAGGCTGAGGGTGGGCGG - Intergenic
1138481343 16:57305385-57305407 TTTTCTTGGCTGAGGGTGGAGGG + Intergenic
1139174872 16:64674789-64674811 CTTTTTAGGGTGAGGCTGGAGGG - Intergenic
1202998561 16_KI270728v1_random:141487-141509 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1203082293 16_KI270728v1_random:1153283-1153305 ATTTCTATGCAAAGTGTGGATGG - Intergenic
1203130158 16_KI270728v1_random:1677891-1677913 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1147482142 17:40776226-40776248 ATTTCAAGGCTGGGAGTGGGAGG - Intergenic
1148643608 17:49206383-49206405 ATTCCTAGGATGAGAGTAGAGGG + Exonic
1150126232 17:62636987-62637009 AGCTCTGGACTGAGGGTGGAAGG - Intronic
1150684878 17:67312501-67312523 GTTGCCAGGCAGAGGGTGGATGG - Intergenic
1150872547 17:68929513-68929535 ATTTTTAGGCTATAGGTGGATGG + Intronic
1151557509 17:74854089-74854111 ATGTCTAGGCTGAGGGCCTAAGG - Intronic
1152188602 17:78874429-78874451 TTTTCTGGGCTGAGGGCAGAGGG + Intronic
1153032833 18:731084-731106 ATTGCTAGGGTTGGGGTGGAGGG + Intronic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1154026196 18:10709506-10709528 ATTTCCAGGCTGAACGTGGTAGG + Intronic
1155324055 18:24648364-24648386 ATTTCTGGGGTGGGGATGGAGGG + Intergenic
1155710810 18:28876843-28876865 ATTTCTAGACTTAGTGAGGAAGG + Intergenic
1156412311 18:36842498-36842520 ATCTCAAAGCAGAGGGTGGAAGG + Intronic
1157790397 18:50525912-50525934 AGTTCGAGGCTGAGGCTGCAGGG + Intergenic
1159804092 18:72934301-72934323 ATTTGTATTCTGAGGGTGGATGG + Intergenic
1159923290 18:74246089-74246111 ATGTCTAGCTTGAGGGTGGGTGG - Intergenic
1161532967 19:4801118-4801140 ATATCAAGGCACAGGGTGGAGGG - Exonic
1164511950 19:28904675-28904697 TTTTCTAGGCCGGGGGTGGGGGG + Intergenic
1165402994 19:35613650-35613672 ATTCCTAGGGTGATGGTGGTAGG - Intronic
1165610366 19:37146425-37146447 ATTTGAGAGCTGAGGGTGGAGGG + Intronic
1165673123 19:37696531-37696553 ATTTCTGGGGTGAGGGCGAAAGG + Exonic
1166523236 19:43495206-43495228 CTTTCAAGTCTGAGGGAGGAGGG + Intronic
1167738521 19:51311227-51311249 ACTCCTGGGCTGAGGGAGGAGGG + Intergenic
1168250185 19:55137481-55137503 ACTCCTGGGCTGAGGGAGGAGGG - Intronic
1168250270 19:55137732-55137754 ACTCCTGGGCTGAGGGAGGAGGG - Intronic
1168283799 19:55320700-55320722 ACTCCTGGTCTGAGGGTGGAGGG - Intronic
1168640715 19:58029537-58029559 AGTTCCAGGCGGAGGGTGGAGGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
926436632 2:12844870-12844892 ATTTTTAGTCTGAGTCTGGAAGG - Intergenic
927917374 2:26945771-26945793 AACTCCAGGCTGTGGGTGGAAGG - Intronic
928929260 2:36607146-36607168 ATCTCAAGGCAGAAGGTGGAAGG + Intronic
929535712 2:42783133-42783155 CTTTGTTGGCTGATGGTGGAGGG - Intronic
930653148 2:53982580-53982602 AATTCTAGGCAGTGGGTGGAAGG - Intronic
930903307 2:56534231-56534253 ATTTCTATGCTTGGGGTTGAGGG - Intergenic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
932285933 2:70531742-70531764 ATGTCAAGGATGTGGGTGGAAGG + Intronic
932501339 2:72185494-72185516 CTTTCTTGGCTGAGGGTATAGGG - Intronic
933886468 2:86722324-86722346 ATTTCTAGGAGGACAGTGGAGGG + Intronic
933923712 2:87074381-87074403 ATTTCTAGGAGGACAGTGGAGGG - Intergenic
934318101 2:91944806-91944828 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
936116041 2:109704020-109704042 CTACCTAGGCTGAGGGTGGTGGG + Intergenic
936630622 2:114199018-114199040 CTTTCCAGGCTGAGGGAGAAAGG - Intergenic
937068184 2:119036142-119036164 ATATATAGGCTGAAGGTGAAGGG + Intergenic
937993179 2:127675224-127675246 AGGTCAAGGCTGAGGGTGGTGGG + Intronic
941640052 2:167977731-167977753 ATTTCTGGGGAGAGGGTGTATGG + Intronic
946311010 2:218882628-218882650 CTGTGTAGGCTGAGGGTGGCAGG + Intronic
947073769 2:226319409-226319431 ATATGTAGGCTGAGGCTAGACGG - Intergenic
947644436 2:231727999-231728021 TTTTGTGGGCTGAGGGTTGAAGG + Intergenic
948414357 2:237791498-237791520 ATTGATAGGATGAGAGTGGAGGG - Intronic
948866121 2:240775724-240775746 CTTTCTGGGCTGAGGCTGGGAGG - Intronic
949032897 2:241805327-241805349 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949032994 2:241805557-241805579 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033010 2:241805596-241805618 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033041 2:241805670-241805692 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033057 2:241805709-241805731 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033087 2:241805783-241805805 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033103 2:241805822-241805844 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033119 2:241805861-241805883 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033135 2:241805900-241805922 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033177 2:241806003-241806025 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033255 2:241806190-241806212 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033269 2:241806225-241806247 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033396 2:241806533-241806555 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033442 2:241806646-241806668 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033458 2:241806685-241806707 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033488 2:241806759-241806781 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033552 2:241806915-241806937 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033582 2:241806989-241807011 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033596 2:241807024-241807046 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033612 2:241807063-241807085 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033628 2:241807102-241807124 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033659 2:241807180-241807202 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033675 2:241807219-241807241 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033690 2:241807258-241807280 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033719 2:241807336-241807358 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949034029 2:241808100-241808122 TTTCCTGGGCTGAGGGGGGAGGG - Intergenic
1168965829 20:1897340-1897362 ATTTCTTGGTCGAGGGTGGTGGG + Intronic
1169377176 20:5075479-5075501 TTTGGGAGGCTGAGGGTGGATGG + Intronic
1171313941 20:24169537-24169559 ATTTCTAAGATGAGGGTGTCAGG - Intergenic
1172250523 20:33476025-33476047 CTTTCTGGGCTGTGGGCGGATGG - Intergenic
1173664337 20:44754180-44754202 ATCCCAAGGCTGGGGGTGGAAGG - Intronic
1174239237 20:49119689-49119711 ATTTGTAGGATGAGGATGAAGGG - Intronic
1175895544 20:62334146-62334168 ACTTCTAGGCTGAGCCTGGGAGG + Intronic
1179510139 21:41867114-41867136 CTTTCTGGGCTGAGGGTGTCGGG - Intronic
1180306273 22:11128490-11128512 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1180544792 22:16490673-16490695 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1180844261 22:18972857-18972879 ACTTCCAGGCTGAGGCTGGGCGG + Intergenic
1181057210 22:20265854-20265876 ACTTCCAGGCTGAGGCTGGGCGG - Intronic
1182654089 22:31876024-31876046 ATGTCTAATCTGGGGGTGGAGGG + Intronic
1183281138 22:36933366-36933388 ATTTCTAGACTGAAGGTGTGGGG - Intronic
1184786110 22:46672721-46672743 ACATCCAGGCTCAGGGTGGAGGG + Intronic
951098548 3:18659773-18659795 ATTTGTGGGTAGAGGGTGGAAGG + Intergenic
952947643 3:38490132-38490154 ATTTTTAGGCAGAGAGTGGATGG + Exonic
953877371 3:46674001-46674023 TTTTGGAGACTGAGGGTGGAAGG + Intronic
954448623 3:50559871-50559893 ATTTGTAGGCTGAGCTTGCAGGG - Intronic
955978811 3:64503825-64503847 ATTTCTAGGCTGACTGTAGAGGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
963706432 3:148694038-148694060 TTGCCTAGGCTGAGAGTGGAGGG - Intergenic
966845887 3:184129440-184129462 TCTTCTAGGCTGAGGTTTGAGGG - Intergenic
969186443 4:5478137-5478159 ATTTTTAGGGTGAGAATGGATGG - Intronic
969408361 4:7010550-7010572 ACTTCTAGTGTGAGGGTGGTAGG + Intronic
971004772 4:22360877-22360899 ATTTCTTGGTTGTGGCTGGAGGG - Intronic
971428014 4:26534949-26534971 AATTCTATGATGAGGGTGTAGGG - Intergenic
973200820 4:47500202-47500224 ATTTCTACGCTGATGGAGGAGGG + Intronic
973800700 4:54474933-54474955 TTGGCTATGCTGAGGGTGGATGG + Intergenic
974729806 4:65847548-65847570 ATTTCTAGGATGGAGGTGGGAGG - Intergenic
974800096 4:66805780-66805802 ATTGATAGGCTTGGGGTGGATGG + Intergenic
975462561 4:74671412-74671434 ATTTGAAGGCTGAGGGCAGAGGG + Intergenic
975587416 4:75964313-75964335 ATTCCTAAACTGAAGGTGGAAGG - Intronic
977950585 4:102966093-102966115 TTTTCCAGGCTGAGGTTGTATGG + Intronic
981706901 4:147669266-147669288 ATTGCGAGGCTGAGGTGGGAGGG + Intronic
982636190 4:157899714-157899736 ATGTGTGGGCTGAGGGAGGAGGG + Intergenic
983005105 4:162475142-162475164 ACTTCTTGGCTGAGGTTGGAGGG + Intergenic
983647339 4:170005069-170005091 GTTTCTAGGCTGAGGCAGGGAGG - Intronic
983864462 4:172748200-172748222 AGTTCAGGGATGAGGGTGGACGG + Intronic
984905024 4:184618523-184618545 AGTTCTAGGCTGTGAGGGGATGG - Intergenic
985441541 4:189984970-189984992 AATCCTAGGCTGAGGGAGGTGGG - Intergenic
985942137 5:3145282-3145304 ATTTCTAGGCAAAGTGTTGAAGG + Intergenic
989160598 5:38387106-38387128 TTTTCTGGGCTGAGTGTGGAGGG + Intronic
989273453 5:39558803-39558825 ATTTCTGGGCACAGAGTGGAAGG + Intergenic
989332743 5:40278816-40278838 CTATCCAGGCTGAGGGAGGAAGG + Intergenic
989651832 5:43698957-43698979 GTATTTAGGCTGAGGTTGGATGG + Intronic
990020750 5:51124427-51124449 ATTTCTAGCTTGAAGGTGGATGG + Intergenic
990487182 5:56270745-56270767 ATTTGCAGGCTGAGGGTTAAAGG - Intergenic
991240708 5:64456998-64457020 ATGTTTAAGCTGAGGGTTGACGG - Intergenic
992112403 5:73508547-73508569 ATTTTTAGGCTGATGGTGAGGGG - Intergenic
993281301 5:85928207-85928229 ATTTCTAGTTTGAAGATGGAGGG + Intergenic
993842694 5:92900460-92900482 ATTACCAGACTGAGTGTGGAAGG - Intergenic
995058446 5:107788195-107788217 ATTTCTAAGCAAAGGGTTGAAGG + Intergenic
997348242 5:133209614-133209636 CTTTCTTGGCTGATGGGGGAAGG + Intronic
997399296 5:133590258-133590280 ATCTCTAGGGTGAGGATGAAAGG - Intronic
998362376 5:141600133-141600155 ATTTCTGGCATGAAGGTGGAGGG + Intronic
998578086 5:143339707-143339729 CCTTCTAGGCTGAGGGTTGGTGG + Intronic
999807382 5:155095235-155095257 ACTTGAAGGCGGAGGGTGGAAGG + Intergenic
1006865788 6:37208108-37208130 ATTTCTACCCTGAGTGTGGTGGG + Intergenic
1007791855 6:44313738-44313760 TTTTCCAGGCTGAGGGAAGAAGG + Intronic
1008125090 6:47659049-47659071 ATTCCTGGGGTGAGGATGGATGG + Exonic
1010022833 6:71181109-71181131 ATTTTTATGCTGAGGGGGAAAGG + Intergenic
1010693218 6:78935214-78935236 ATTTCTAAGTTGAGGAAGGAAGG - Intronic
1011246244 6:85324089-85324111 AATTCTATGCTGTGTGTGGATGG - Intergenic
1012111048 6:95234108-95234130 ACTTCAAGGCTGTGGGTGGCCGG - Intergenic
1013036427 6:106388403-106388425 GTTTCTGGGCTGGGGGTAGAGGG - Intergenic
1013634931 6:112020233-112020255 ATTACTAGGCTGACAGTGTAAGG + Intergenic
1015437019 6:133201345-133201367 ATTGGTAAGCTGAGGGTAGAAGG - Intergenic
1015586804 6:134784687-134784709 ATTTCTAGGGTTAGGGACGATGG - Intergenic
1015634676 6:135263750-135263772 ATCCCTTGGCTGAAGGTGGAGGG + Intergenic
1015900739 6:138063156-138063178 ATTCCTAGGATGATGGTGAAAGG + Intergenic
1015964048 6:138680722-138680744 ATTGGGAGGCTGAGGCTGGAGGG - Intronic
1016979022 6:149837297-149837319 ATTGCTAGGCAGTGGCTGGAAGG - Intronic
1017492124 6:154953891-154953913 ACTTGGAGGCTGAGGGTGGGAGG + Intronic
1018428905 6:163708214-163708236 TGTTCTGGGCTCAGGGTGGACGG + Intergenic
1018805373 6:167255230-167255252 ATTTCTAAGCTAAGGGTTAAAGG - Intergenic
1019723358 7:2586910-2586932 AGTGTTAGGCAGAGGGTGGAGGG + Intronic
1021523400 7:21559079-21559101 ATTTGGAGGCTGAGGTGGGAGGG + Intronic
1022429900 7:30307344-30307366 TTTTTTTGGCTGGGGGTGGAGGG + Intronic
1022907557 7:34871568-34871590 TTTTACAGGCTGATGGTGGAAGG - Intronic
1023963033 7:44943644-44943666 TTTCCAAGGCTGAGGCTGGAAGG + Intergenic
1026128912 7:67604424-67604446 ATTTAAAGTCTGAGGGAGGAGGG + Intergenic
1026347111 7:69483629-69483651 ATTCCTAGCCTAAAGGTGGAAGG + Intergenic
1027381158 7:77611354-77611376 ATTACTTGGGTGGGGGTGGAAGG - Intronic
1027468745 7:78547557-78547579 ATTTCAGGGCTGAGGATGGCTGG + Intronic
1028183137 7:87748776-87748798 ATTTCAAAGCTGAGGAGGGAAGG + Intronic
1028261589 7:88673538-88673560 ATTTCCTGGTTGATGGTGGAGGG + Intergenic
1028396532 7:90375216-90375238 ATTTCCAGGGTTAGGGAGGAAGG + Intronic
1028473220 7:91226828-91226850 ATTTCTAGGCAGAATGTTGAAGG - Intergenic
1028616408 7:92772711-92772733 ATCTCAAGGGTGAGGGTGGAGGG - Intronic
1028973013 7:96880329-96880351 CTTTCTAGGATGAGTTTGGAAGG - Intergenic
1029991047 7:104962774-104962796 TTCTCTAGGCTGAGGGAGGAGGG - Intergenic
1032669905 7:134073315-134073337 GTTTCTATGATGAGGATGGATGG - Intergenic
1032893090 7:136220775-136220797 ATTTCTGGGCAGAGTGTTGAAGG + Intergenic
1033212814 7:139472850-139472872 ATCTTTGGGCTGGGGGTGGAGGG - Intronic
1033653745 7:143360530-143360552 TTCTCTATGCTTAGGGTGGAAGG + Intronic
1035092973 7:156329746-156329768 TTTTCTGAGCAGAGGGTGGAAGG - Intergenic
1037090631 8:14912399-14912421 ATTTCTATGCTGAGGTAAGATGG - Intronic
1037142788 8:15538956-15538978 ATTCCAAGACTGAGGCTGGAAGG - Intronic
1037907745 8:22725398-22725420 ATTTCTTGGCTGCGTCTGGAGGG + Intronic
1038115785 8:24553733-24553755 ATGTGCAGGCTGAAGGTGGAAGG - Intergenic
1038530119 8:28311803-28311825 GGTTCAGGGCTGAGGGTGGAAGG + Intergenic
1039132518 8:34283369-34283391 TTTTCTAGGAAGAGGGTGGTAGG + Intergenic
1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG + Intergenic
1041223162 8:55671690-55671712 ATTTCATGGCAGAAGGTGGAAGG - Intergenic
1041976576 8:63805684-63805706 ATTTCCAGGTGTAGGGTGGAGGG - Intergenic
1044100381 8:88128798-88128820 ATTTATAGGCTGTGGAAGGAGGG + Intronic
1045993904 8:108340985-108341007 ATTTCTAAGCTGAGGCGTGAAGG - Intronic
1049016629 8:139924580-139924602 ATTCCTAGGCTAAGAGTTGAAGG - Intronic
1049169370 8:141149545-141149567 AGTTCAGGGTTGAGGGTGGACGG + Intronic
1050269358 9:3925681-3925703 AGTTCAAGGTTGAGGGTGGCTGG - Intronic
1050899593 9:10929678-10929700 ATTTTTAGGCTGAGGGGAAATGG - Intergenic
1051256282 9:15217043-15217065 ATATCTAGGTTGAGGGCAGAGGG + Intronic
1051295370 9:15589259-15589281 AAGTCTATGCTGAGGATGGAAGG - Intronic
1052915771 9:33923454-33923476 GTTGCTTGGCTGAGGCTGGAGGG + Exonic
1053034385 9:34811490-34811512 ATTTCATGGCAGAAGGTGGAAGG - Intergenic
1053314754 9:37041871-37041893 CATTCCAGGCTGAGGGTGGTTGG - Intergenic
1055395096 9:75865722-75865744 TTTTCCAGGCTGAGGGTGGTTGG - Intergenic
1057023674 9:91719742-91719764 ACTTGTAGGGGGAGGGTGGAGGG + Intronic
1061403476 9:130381268-130381290 AATTCTAGGCTGGGGCTGGCCGG - Intronic
1062215292 9:135385825-135385847 ATTTCTGGGGTGAGAGAGGATGG + Intergenic
1186223200 X:7371434-7371456 AATTCTAGGCAGAAGGTGGTAGG + Intergenic
1187362413 X:18640976-18640998 ATTGCAAGGCAGAGGGTGGAGGG + Exonic
1188196693 X:27243200-27243222 TTATCTAGGCTGAGGGTGGGTGG - Intergenic
1189925901 X:45954436-45954458 ATTTCTACCCAGATGGTGGAGGG - Intergenic
1194239026 X:91421273-91421295 ATTGCTAGAATGTGGGTGGAAGG - Intergenic
1195555098 X:106212629-106212651 TCTGCTAGGCTGAGGGTTGAGGG - Intergenic
1196650703 X:118165639-118165661 ATGTCATGGCTGAGGTTGGAGGG - Intergenic
1196940919 X:120775025-120775047 GTTGCTAGCTTGAGGGTGGAAGG - Intergenic
1198910370 X:141606936-141606958 ATTGTTGGGCTGAGGTTGGAAGG + Intronic
1199969593 X:152849686-152849708 ATTTCTAGGCTGAGGCAAGAAGG + Intronic
1201185656 Y:11399888-11399910 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic
1202176510 Y:22103581-22103603 AATTCTAGGATGATGGAGGAGGG + Intergenic
1202214851 Y:22482803-22482825 AATTCTAGGATGATGGAGGAGGG - Intergenic