ID: 910360231

View in Genome Browser
Species Human (GRCh38)
Location 1:86408765-86408787
Sequence CGGTAAATGTCTGGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910360225_910360231 -5 Left 910360225 1:86408747-86408769 CCTTTTGGGGAGAGCAGTCGGTA No data
Right 910360231 1:86408765-86408787 CGGTAAATGTCTGGGGTGGAGGG No data
910360224_910360231 -4 Left 910360224 1:86408746-86408768 CCCTTTTGGGGAGAGCAGTCGGT No data
Right 910360231 1:86408765-86408787 CGGTAAATGTCTGGGGTGGAGGG No data
910360219_910360231 30 Left 910360219 1:86408712-86408734 CCAGAATAGTCTTTGAAAGCTCT No data
Right 910360231 1:86408765-86408787 CGGTAAATGTCTGGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910360231 Original CRISPR CGGTAAATGTCTGGGGTGGA GGG Intergenic
No off target data available for this crispr