ID: 910361241

View in Genome Browser
Species Human (GRCh38)
Location 1:86415323-86415345
Sequence CAGGGGAAACTCTGCTCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910361241_910361248 20 Left 910361241 1:86415323-86415345 CCAGATGAGCAGAGTTTCCCCTG No data
Right 910361248 1:86415366-86415388 CCTAACTCTCACAACTCAGTTGG No data
910361241_910361252 28 Left 910361241 1:86415323-86415345 CCAGATGAGCAGAGTTTCCCCTG No data
Right 910361252 1:86415374-86415396 TCACAACTCAGTTGGGGTATGGG No data
910361241_910361250 22 Left 910361241 1:86415323-86415345 CCAGATGAGCAGAGTTTCCCCTG No data
Right 910361250 1:86415368-86415390 TAACTCTCACAACTCAGTTGGGG No data
910361241_910361251 27 Left 910361241 1:86415323-86415345 CCAGATGAGCAGAGTTTCCCCTG No data
Right 910361251 1:86415373-86415395 CTCACAACTCAGTTGGGGTATGG No data
910361241_910361249 21 Left 910361241 1:86415323-86415345 CCAGATGAGCAGAGTTTCCCCTG No data
Right 910361249 1:86415367-86415389 CTAACTCTCACAACTCAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910361241 Original CRISPR CAGGGGAAACTCTGCTCATC TGG (reversed) Intergenic
No off target data available for this crispr