ID: 910361245

View in Genome Browser
Species Human (GRCh38)
Location 1:86415341-86415363
Sequence AGCAGTGCCGTCAGCATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910361245_910361250 4 Left 910361245 1:86415341-86415363 CCCTGGATGCTGACGGCACTGCT No data
Right 910361250 1:86415368-86415390 TAACTCTCACAACTCAGTTGGGG No data
910361245_910361249 3 Left 910361245 1:86415341-86415363 CCCTGGATGCTGACGGCACTGCT No data
Right 910361249 1:86415367-86415389 CTAACTCTCACAACTCAGTTGGG No data
910361245_910361248 2 Left 910361245 1:86415341-86415363 CCCTGGATGCTGACGGCACTGCT No data
Right 910361248 1:86415366-86415388 CCTAACTCTCACAACTCAGTTGG No data
910361245_910361252 10 Left 910361245 1:86415341-86415363 CCCTGGATGCTGACGGCACTGCT No data
Right 910361252 1:86415374-86415396 TCACAACTCAGTTGGGGTATGGG No data
910361245_910361251 9 Left 910361245 1:86415341-86415363 CCCTGGATGCTGACGGCACTGCT No data
Right 910361251 1:86415373-86415395 CTCACAACTCAGTTGGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910361245 Original CRISPR AGCAGTGCCGTCAGCATCCA GGG (reversed) Intergenic
No off target data available for this crispr