ID: 910361251

View in Genome Browser
Species Human (GRCh38)
Location 1:86415373-86415395
Sequence CTCACAACTCAGTTGGGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910361245_910361251 9 Left 910361245 1:86415341-86415363 CCCTGGATGCTGACGGCACTGCT No data
Right 910361251 1:86415373-86415395 CTCACAACTCAGTTGGGGTATGG No data
910361244_910361251 10 Left 910361244 1:86415340-86415362 CCCCTGGATGCTGACGGCACTGC No data
Right 910361251 1:86415373-86415395 CTCACAACTCAGTTGGGGTATGG No data
910361241_910361251 27 Left 910361241 1:86415323-86415345 CCAGATGAGCAGAGTTTCCCCTG No data
Right 910361251 1:86415373-86415395 CTCACAACTCAGTTGGGGTATGG No data
910361246_910361251 8 Left 910361246 1:86415342-86415364 CCTGGATGCTGACGGCACTGCTT No data
Right 910361251 1:86415373-86415395 CTCACAACTCAGTTGGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910361251 Original CRISPR CTCACAACTCAGTTGGGGTA TGG Intergenic
No off target data available for this crispr