ID: 910363730

View in Genome Browser
Species Human (GRCh38)
Location 1:86441490-86441512
Sequence GCTTTCAGTAGAATTTCCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910363728_910363730 10 Left 910363728 1:86441457-86441479 CCAGATATATCAAACTCCAATAG 0: 1
1: 0
2: 0
3: 2
4: 96
Right 910363730 1:86441490-86441512 GCTTTCAGTAGAATTTCCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 142
910363729_910363730 -6 Left 910363729 1:86441473-86441495 CCAATAGCATGATTGATGCTTTC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 910363730 1:86441490-86441512 GCTTTCAGTAGAATTTCCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910363730 Original CRISPR GCTTTCAGTAGAATTTCCTC TGG Exonic
900905263 1:5552655-5552677 GCTTTCAGGAGAATGTGGTCTGG + Intergenic
905671279 1:39791876-39791898 GCTTACAGCAGAATTTCCCCAGG + Intergenic
906330515 1:44880280-44880302 GATTTTAGTGGGATTTCCTCAGG - Intronic
908622524 1:66000377-66000399 GCTTTTAATAGGATTTCCCCAGG + Intronic
910363730 1:86441490-86441512 GCTTTCAGTAGAATTTCCTCTGG + Exonic
910753559 1:90661086-90661108 GCCTTCAGGAAAAATTCCTCAGG + Intergenic
911249689 1:95560728-95560750 GAATTCTGTAGAATTTGCTCAGG - Intergenic
911506118 1:98754025-98754047 GCTTTTTGTAGATGTTCCTCGGG + Intronic
913270813 1:117091538-117091560 GCAATCAGTAGATTTTACTCTGG - Intronic
915455263 1:156036296-156036318 TCTTTCACACGAATTTCCTCTGG + Exonic
915826242 1:159080578-159080600 GCATGCATTAGAATTTCCTGGGG + Intronic
923007043 1:230058351-230058373 CCTTTCAGCAGAATGTCCCCAGG + Intronic
923551069 1:234963787-234963809 TGTTTCTGTAGAATTTTCTCCGG - Intergenic
924195702 1:241604727-241604749 ATTTTCAGTATAATTTCCTTGGG - Intronic
924820783 1:247488240-247488262 GTTTTCAGTGTAATTTCCTCTGG + Intergenic
1063242267 10:4183202-4183224 GCTTTCAGTGGAATTTAATTTGG - Intergenic
1064004625 10:11690147-11690169 GGTTTCAGTGGAATTTACACTGG + Intergenic
1064246368 10:13670492-13670514 GCTGCCAGTAGAATATCCCCTGG - Exonic
1064889851 10:20158825-20158847 GCTTTCTCTAAAATTTCCTATGG - Intronic
1064937910 10:20699756-20699778 GTATTTAGTAGAATTTCCTCTGG - Intergenic
1065311043 10:24416101-24416123 GCTTTCAATAGGCTTTCCTAGGG - Intronic
1066194491 10:33085625-33085647 GCTGTCACTAGAATTTACTCAGG + Intergenic
1066754022 10:38691727-38691749 TCTTTCAGTAGATTTTTCCCTGG - Intergenic
1068492004 10:57736277-57736299 GCTTCTATTAGTATTTCCTCTGG - Intergenic
1069275351 10:66584793-66584815 GCTTTCAGGAGTATTTATTCTGG + Intronic
1069512473 10:69052654-69052676 GCATGCTGTAGAATTTCCTTAGG + Intergenic
1070671038 10:78377398-78377420 GCTTTCAGGAGAACTGCCTGAGG + Intergenic
1072546271 10:96441949-96441971 ACTTTCAGTAACATTTCCTAGGG - Intronic
1074768907 10:116720619-116720641 GCTTTCACTAGCATTTATTCTGG - Intronic
1074805067 10:117041297-117041319 ACTTTCTGTTGAATTTCCTTTGG - Intronic
1076422236 10:130339678-130339700 GCATTTAGATGAATTTCCTCTGG - Intergenic
1084885778 11:72205902-72205924 GCTCTCAGAGGAATTCCCTCTGG - Intergenic
1086408440 11:86519891-86519913 GCTTTCTGTGGAACGTCCTCAGG + Intronic
1093497311 12:19773071-19773093 GCTTACAATAGAATTCCCTTAGG - Intergenic
1093872199 12:24306125-24306147 ACTTTCAGGAGAATTTTCTATGG - Intergenic
1101012431 12:100464889-100464911 GCTTTCTGTGAAATGTCCTCAGG - Intergenic
1102220713 12:111192522-111192544 GCTTTCACTAGATCTTCATCAGG + Intronic
1107369059 13:39722340-39722362 TCTTTCAGTAGTGTTGCCTCAGG + Intronic
1108446773 13:50517350-50517372 GCTTTTAACAGAATTCCCTCTGG - Intronic
1108570350 13:51743576-51743598 TCTCTCTGTAGAATTTCCTATGG + Intronic
1108813689 13:54264241-54264263 TCTTTCACTAGAATGTCCTGGGG - Intergenic
1109317528 13:60767871-60767893 TCTTTCAGTATAATTACTTCGGG + Intergenic
1109947218 13:69451944-69451966 GATTTGAGTATAATTTTCTCTGG - Intergenic
1110895380 13:80744482-80744504 GCTTTGACTAGAATTTATTCTGG + Intergenic
1115050129 14:29049810-29049832 TCTTTCTGAAGAATTTCCTTAGG + Intergenic
1117495961 14:56304384-56304406 GCTTACATCAGAATTTCCTGAGG + Intergenic
1118389933 14:65287497-65287519 GGTTTCATCAGAATTCCCTCAGG + Intergenic
1118572032 14:67203578-67203600 GCTTCCAGCAGAATTAGCTCTGG + Intronic
1120264617 14:82233171-82233193 GCTTTCACTAAAATTTTCACCGG - Intergenic
1125358786 15:38844369-38844391 GCCTGCAATGGAATTTCCTCTGG - Intergenic
1125366532 15:38922481-38922503 TAATTCAGTAGGATTTCCTCTGG + Intergenic
1126560397 15:50036565-50036587 GGTTTCTGTAGAATGTGCTCAGG - Intronic
1126672587 15:51129725-51129747 GCTTGCAGCAGAATTTTCTAGGG + Intergenic
1127250697 15:57234046-57234068 GCTTCCAGCAGCATTCCCTCTGG - Exonic
1127639077 15:60898353-60898375 TCTTTCTGTATAATTTTCTCAGG + Intronic
1129243322 15:74264647-74264669 TCTCCCAGTTGAATTTCCTCAGG + Intronic
1130732684 15:86515276-86515298 GCTCTTAGTGGAAATTCCTCTGG + Intronic
1132323735 15:100948013-100948035 GCTTTCAGTGGAATTCCCCGTGG - Intronic
1136728707 16:32385362-32385384 TCTTTCAGTAGATTTTTCCCTGG + Intergenic
1137778022 16:51072554-51072576 GCTTTGTGTAGACTTTCTTCAGG + Intergenic
1202997729 16_KI270728v1_random:132381-132403 TCTTTCAGTAGATTTTTCCCTGG - Intergenic
1203024416 16_KI270728v1_random:444723-444745 TCTTTCAGTAGATTTTTCCCTGG - Intergenic
1148008009 17:44449836-44449858 GCTTTCAGCAGAATCACCTTGGG - Intronic
1148063548 17:44852721-44852743 GCTCTCAGTATAATTCCCTGTGG + Intronic
1154410248 18:14136558-14136580 GTGTTCTGTAGAATTTGCTCAGG - Intergenic
1155438946 18:25841720-25841742 GCTTTAGGTAGAATTGGCTCAGG - Intergenic
1156760099 18:40578325-40578347 GCTGTCTGTAGTATTTTCTCAGG - Intergenic
1159862146 18:73661902-73661924 ACTCTCAGCAGAATTTCTTCTGG - Intergenic
1162862684 19:13518935-13518957 GCTTTCATTATAATATCCTTGGG - Intronic
1167982463 19:53286384-53286406 GAATTCAGGAGAGTTTCCTCAGG - Intergenic
927360824 2:22230706-22230728 GCTTTCAGAAAAATTTCCCTAGG - Intergenic
927368704 2:22329525-22329547 GCTTTCAGCAGATGTTCCACAGG + Intergenic
929859133 2:45660931-45660953 GATTTCAGTTATATTTCCTCTGG - Intronic
930856075 2:56020049-56020071 ACGCTTAGTAGAATTTCCTCTGG - Intergenic
931223646 2:60310496-60310518 GCTATCAGTAGCATTTGCTCAGG - Intergenic
934317320 2:91936066-91936088 TCTTTCAGTAGATTTTTCCCTGG - Intergenic
935477879 2:103546998-103547020 CATTTCTGTAAAATTTCCTCAGG + Intergenic
937052851 2:118906433-118906455 ACTTTCAGTAGAAATACCCCTGG - Intergenic
939295147 2:140253663-140253685 GCTTTCAGTAAAATTTTCTCTGG - Intronic
943135723 2:183909557-183909579 GCTTTCAGTATAATCTTTTCAGG + Intergenic
943532457 2:189100464-189100486 TCTTTCAGTAGTTTTTCCTCTGG - Intronic
945633512 2:212316524-212316546 GCTTTCAGGTGAATTTACTTTGG + Intronic
946750858 2:222895264-222895286 GCTTGCAGAAGATTTTCTTCTGG - Intronic
946866827 2:224048520-224048542 GCTTTCTGTTCACTTTCCTCTGG - Intergenic
947046802 2:225996277-225996299 ACTTACATTAGGATTTCCTCAGG + Intergenic
947218568 2:227771302-227771324 GTTTTCCCTAGAGTTTCCTCGGG + Intergenic
947589187 2:231375425-231375447 GCTTGCAGCAGTATTGCCTCTGG - Intergenic
1170925525 20:20719511-20719533 GATTTCAGCAGACTTTCATCTGG + Intergenic
1172383271 20:34514618-34514640 GCATTCAATAGAAATTCCTTTGG + Intergenic
1173115483 20:40238206-40238228 TCTTTCAGTATAATGTCATCTGG + Intergenic
1173811086 20:45956122-45956144 GGGTTCAGAAGAATTTCTTCAGG - Intronic
1174853124 20:54016071-54016093 GCATGCAGAAGAATCTCCTCTGG - Intronic
1176862811 21:14021857-14021879 GTGTTCTGTAGAATTTGCTCAGG + Intergenic
1176956161 21:15106533-15106555 GCTTCCTATAGAATTTCCCCAGG + Intergenic
1177509741 21:22069885-22069907 GTTTTCAGTAGAATTTAAACAGG - Intergenic
1178710631 21:34913298-34913320 GCTTTGCGTAGACTTTTCTCTGG + Intronic
1179081946 21:38179473-38179495 GCTTTCAGAAGCCTTTCCTGAGG - Intronic
1180305493 22:11119855-11119877 TCTTTCAGTAGATTTTTCCCTGG - Intergenic
1180544012 22:16482034-16482056 TCTTTCAGTAGATTTTTCCCTGG - Intergenic
1181394792 22:22613423-22613445 ACTTTTATCAGAATTTCCTCAGG + Intergenic
951810257 3:26690577-26690599 GCTCTGAGTTGATTTTCCTCTGG - Intronic
952195916 3:31075225-31075247 TCTTGCAGTGGGATTTCCTCCGG - Intergenic
959533379 3:107458774-107458796 GAGTTCAGTAGAACTCCCTCAGG + Intergenic
960903479 3:122574832-122574854 TCTTCCAATAGGATTTCCTCTGG - Exonic
963484153 3:145915120-145915142 GCTTTCAGTAGTATTTTTTCTGG - Intergenic
964503109 3:157369992-157370014 GATTTCTGTAAAATTACCTCTGG - Intronic
965447779 3:168797190-168797212 GTTTTCTGTAGAATTTACTTGGG + Intergenic
966880601 3:184347893-184347915 GCTTTAAGTAGATTTTCTTGGGG + Intronic
967497624 3:190159520-190159542 GCTTCCTGTAGAATTCCTTCAGG + Intergenic
972752370 4:42004533-42004555 GCATTCTGTATTATTTCCTCAGG + Intronic
972975339 4:44627316-44627338 TCTTTCAGTAGGCTTTCTTCAGG - Intronic
973218183 4:47695383-47695405 GCTTTCAGTTCCATTTCCTGAGG - Intronic
974620738 4:64350303-64350325 GCTTTCAGAAAAATGTCCTGTGG + Intronic
975706763 4:77119716-77119738 GCATTCTATATAATTTCCTCAGG + Intergenic
977949561 4:102954700-102954722 TCTTTCAGTAGATTTTTCCCTGG - Intronic
979648008 4:123094360-123094382 GGTTTCTGTAGGATTTCCTTTGG + Intronic
988679120 5:33467022-33467044 GGTTTCAGTAGATTTTCCTGAGG - Intronic
988720920 5:33878340-33878362 CCTCCCAGTAGAATTTCTTCTGG + Intronic
992057456 5:73005025-73005047 AATTTCAGTTGAATTTCTTCTGG + Intronic
995401885 5:111751627-111751649 ACATTCAGTACATTTTCCTCTGG + Intronic
996922088 5:128780285-128780307 GCTTTCAGTAGAAAAACCTAGGG + Intronic
998708077 5:144787784-144787806 GCTTACATTAGAATTCCTTCGGG - Intergenic
1000968934 5:167692505-167692527 GTTTTCAGTAACATTTCCTGTGG - Intronic
1000994294 5:167943427-167943449 TCTTTAACTAGAATTTCCTGGGG - Intronic
1003150322 6:3542597-3542619 GCTTTCAGTAGAGTCTGCTAAGG - Intergenic
1006564349 6:34941895-34941917 GATCTCAGTATCATTTCCTCTGG - Intronic
1007206510 6:40156591-40156613 CTCTTCAGTAGAATTTCTTCTGG - Intergenic
1008049789 6:46888625-46888647 GATTTCATTAGAAATTCCTAAGG - Intronic
1008952619 6:57176918-57176940 CTTTTCAGTAGCATGTCCTCAGG - Intronic
1010293804 6:74171997-74172019 TATTTCTGAAGAATTTCCTCTGG + Intergenic
1010464859 6:76155410-76155432 GCTTTTTGTAGAATTTCCTAAGG - Intergenic
1013630298 6:111979959-111979981 GCTCTGAGCAGAACTTCCTCAGG - Intergenic
1014486435 6:122004562-122004584 CCTTCCTGTATAATTTCCTCAGG + Intergenic
1021107540 7:16655216-16655238 ACTTTTTTTAGAATTTCCTCTGG - Intronic
1021265493 7:18516275-18516297 CCTTTAAGAAGGATTTCCTCTGG + Intronic
1023350932 7:39319599-39319621 GCTTGCATGAGAATTTCCTCGGG - Intronic
1023517000 7:41011164-41011186 TGTTTCAGTGGAATTCCCTCTGG + Intergenic
1036708482 8:11062023-11062045 GCTTTCAGATGATTTTCCCCTGG - Intronic
1037640623 8:20738992-20739014 GCTTTCTGTAGAAATACCTTAGG + Intergenic
1041077605 8:54183404-54183426 GCCTTTAGTAGAATTTCTTATGG + Intergenic
1045843878 8:106610600-106610622 CCTTTCAGTGGAAGTTCCTCTGG + Intronic
1055302649 9:74898388-74898410 GTTTTCAGTATAACTTCTTCTGG + Intergenic
1056674400 9:88662016-88662038 GCCTTCAGCAGAATCTCCTAAGG + Intergenic
1060086440 9:120707380-120707402 ACTTTCAGTAGCCTTTGCTCAGG - Intronic
1060601277 9:124879680-124879702 GTTTTAGGAAGAATTTCCTCTGG + Exonic
1185554584 X:1010438-1010460 GCTTTCAGGAGAACTGCCTTTGG + Intergenic
1189003053 X:36965179-36965201 CCTTTCAGTAGCAGTTCCCCTGG + Intergenic
1189317174 X:40064359-40064381 GCTTTCAGCAGAGGGTCCTCTGG + Exonic
1189972073 X:46428077-46428099 GCTCTCTGTAGAATTGTCTCAGG + Intergenic
1190465578 X:50722418-50722440 GCACTCAGTAGATTTTCCTCTGG + Intronic
1191585364 X:62820325-62820347 TCTTTCTGTAGAATTTACTAAGG - Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1193944344 X:87714400-87714422 ACATTTAGTAGAATTTTCTCTGG + Intergenic
1198236105 X:134737176-134737198 GCCTGCAGTGGAATTTCCTTGGG - Intronic
1201184631 Y:11388448-11388470 TCTTTCAGTAGATTTTTCCCTGG - Intergenic