ID: 910364579

View in Genome Browser
Species Human (GRCh38)
Location 1:86450889-86450911
Sequence ATCCTCAGTGATTCATGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910364576_910364579 6 Left 910364576 1:86450860-86450882 CCATACATAATTTGTTGACTGTT 0: 1
1: 0
2: 1
3: 49
4: 319
Right 910364579 1:86450889-86450911 ATCCTCAGTGATTCATGGTAGGG 0: 1
1: 0
2: 0
3: 13
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910364579 Original CRISPR ATCCTCAGTGATTCATGGTA GGG Intronic
901727804 1:11255986-11256008 AGCCTCAGTGGTACAGGGTAAGG - Exonic
902956200 1:19925539-19925561 CTCCTCAGTGATTCACTGTTTGG - Intergenic
902956401 1:19926828-19926850 CTCCGCAGTGATTCATTGTTTGG - Intergenic
905056375 1:35097488-35097510 GTATTCAGTGATGCATGGTATGG - Exonic
905512355 1:38531797-38531819 GTCCTCTGTGATTGATGGTCTGG + Intergenic
906218080 1:44055969-44055991 ATGCTCATTGGTTCATAGTAAGG + Intergenic
908930803 1:69314673-69314695 TTCCTCAGTGGTTTATGGTATGG + Intergenic
910364579 1:86450889-86450911 ATCCTCAGTGATTCATGGTAGGG + Intronic
914690965 1:150026548-150026570 ATCCTCAGTGATTTGTGCAAAGG + Intergenic
915494795 1:156274409-156274431 ATCCTCTCTGACTCATGGAAGGG + Intronic
916140286 1:161691397-161691419 TTTCTCAGTTATTCATGTTAGGG + Intergenic
916141378 1:161702247-161702269 AGCCTCAATGATGCTTGGTATGG - Intergenic
917350065 1:174067828-174067850 ATCCTCAGAGATGCCGGGTATGG - Intergenic
917810484 1:178653469-178653491 ACCCTAAGTGGTTCACGGTAGGG + Intergenic
1063164866 10:3452121-3452143 ATCCTCTCTGATTCATGAAAAGG - Intergenic
1064827400 10:19420560-19420582 CTCATCAGTGATTCATGCTCTGG + Intronic
1068036394 10:51765191-51765213 TCCCTCAGTGATTCATTCTATGG - Intronic
1068701150 10:60021381-60021403 ATCTTCAGTGACTCACTGTAAGG + Intergenic
1073056196 10:100704231-100704253 AACCTCACTGATTCATTGTGAGG - Intergenic
1073334884 10:102699254-102699276 ATTCACAGTGATTAATGTTATGG + Intronic
1073878569 10:107952731-107952753 ATCCTCAGTGGTTCAGGTTTGGG - Intergenic
1076260813 10:129064280-129064302 ATCAACAGTTATTCCTGGTAAGG + Intergenic
1076729654 10:132432025-132432047 CTCCTCAGTGATGCAGGGTGGGG + Intergenic
1078965464 11:16335217-16335239 CTATTCAGTGATTCAAGGTAAGG + Intronic
1080549141 11:33354557-33354579 ATGCTCATTGATTCATGATGTGG + Exonic
1084580097 11:70017870-70017892 ATCCTCAGTGGCTCATGGGCAGG + Intergenic
1085003051 11:73058367-73058389 ATACTCAGTGTGACATGGTATGG + Intronic
1086425542 11:86678946-86678968 ATCCTCAGTGAATCAGGCCAAGG - Intergenic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1104429953 12:128708069-128708091 ATCCACAGTGATTCCTAATACGG + Intergenic
1106274904 13:28194943-28194965 ACCCTTAGTGATTCATGCCATGG - Intronic
1111572256 13:90104186-90104208 ATCCTCAGTGACTGAAGGTGTGG + Intergenic
1111662820 13:91232415-91232437 TTCCTCAATGATTCCTGCTAAGG + Intergenic
1120999570 14:90441931-90441953 ATCCCCTGTGCTTCATGGTAGGG + Intergenic
1121740263 14:96246913-96246935 ATGATCACTGGTTCATGGTATGG + Intronic
1121988342 14:98529719-98529741 AACCTCAGTGTTTCTTGGTCTGG - Intergenic
1122348393 14:101074182-101074204 CCCCTCAGTGATCCATGGTTGGG + Intergenic
1124617752 15:31254821-31254843 ATCCTCACTTCTTCATGGCATGG - Intergenic
1129565999 15:76624636-76624658 TTCCTCAGTGATTTATAGTAGGG + Intronic
1129938304 15:79470139-79470161 ATCCTCAGTTTTTCATACTAAGG - Exonic
1142139187 16:88465116-88465138 ATGCTCTGTGGTTCATGGTCTGG - Intronic
1143317710 17:6045210-6045232 TTCCTCAGTGTGTCATGGGAGGG + Intronic
1144224456 17:13131463-13131485 AAGGTCAGAGATTCATGGTAAGG + Intergenic
1155163251 18:23212455-23212477 ATCCCCAGTGGTTAATGGGATGG - Intronic
1155378243 18:25186169-25186191 ATACTCAGTGATCCTTGGTGAGG - Intronic
1155495120 18:26435369-26435391 ATATTCAATGATTCATGTTAAGG + Intergenic
1158803169 18:60937371-60937393 ATCATCAGTTAATCATAGTATGG - Intergenic
1166949209 19:46415287-46415309 ACCCTCAGAGGTACATGGTAAGG + Intergenic
1167320734 19:48796014-48796036 GGTCTCAGTGATTCATGGAAAGG + Intronic
925263210 2:2546074-2546096 CTCCTCAGTGATTCATGCCCTGG + Intergenic
927504251 2:23602994-23603016 ATACTCAGTGACTCATGGATTGG - Intronic
928437444 2:31264068-31264090 ATCCTCAGTAATGCATTGTTAGG + Intronic
932039167 2:68280906-68280928 ATTTTCAGAGATTCATGGTAAGG + Intergenic
932260044 2:70319293-70319315 ATCCTCTGTGATTCATTAGAGGG + Intergenic
937969267 2:127536784-127536806 ACCCTCAGTGAATCATTGTTAGG + Intronic
939376072 2:141369514-141369536 ATCTTGTGTGATTCATGGGAGGG - Intronic
943799182 2:192036410-192036432 AACCTCAGTGATTTAAGGAAAGG + Intronic
946598612 2:221334398-221334420 ATCCTCAGTTCTTCAGGCTATGG + Intergenic
947961556 2:234242252-234242274 ATCCACAGTGATTCATCGCCCGG + Intergenic
1169184344 20:3601522-3601544 ATCTTCAGTGAATCACAGTAAGG - Intronic
1171043850 20:21791989-21792011 ATTCACAGTGACTCATGGCAAGG + Intergenic
1171845247 20:30266854-30266876 ATACTCAGTTTTTCATGGCAGGG + Intergenic
1176694318 21:9956581-9956603 ATTCTCATAGATTCAAGGTAAGG - Intergenic
954546479 3:51440319-51440341 ATGCTCAGTGACACAGGGTATGG + Intronic
955884280 3:63581000-63581022 ATCTTCACTGACTCATTGTATGG - Intronic
960079028 3:113521251-113521273 ATCCTCAATGACACTTGGTATGG - Intergenic
962014451 3:131425825-131425847 ATGCTCAGTGGGTCATGGTCAGG - Intergenic
965533371 3:169799282-169799304 ATTCTCAGTGATTCATACTAAGG + Intronic
966499667 3:180625767-180625789 TTCCTCAGTGACTTAAGGTATGG + Intronic
970882464 4:20947918-20947940 CTCATCACTGATTAATGGTATGG + Intronic
976083287 4:81380284-81380306 ATCATCAATGATTCATAGTTTGG + Intergenic
978628941 4:110720319-110720341 TTTCTCAGTGATTCATGAGATGG - Intergenic
984141793 4:176012768-176012790 ATATTCAGTGATTCATGGATTGG + Intergenic
984463751 4:180070918-180070940 AACCTCAGTAATTAATGGTAAGG - Intergenic
984739538 4:183146887-183146909 ATCCTTAGTCAATCATGGGAGGG + Intronic
986154174 5:5156993-5157015 ATCCCCAGTGATTCCAGGCATGG + Intronic
986694570 5:10340246-10340268 CTCCTCATTGATAGATGGTAGGG - Intergenic
987698879 5:21368511-21368533 ACCCTCAGTGATTCAGTGCATGG - Intergenic
988753772 5:34222955-34222977 ACCCTCAGTGATTCAGTGCATGG + Intergenic
993866178 5:93199196-93199218 ATGCTCACTGATTCTTGGTATGG - Intergenic
996370327 5:122746429-122746451 CTCCTCAGAGAATAATGGTAGGG + Intergenic
998888205 5:146717537-146717559 ATCTTCAGTGCTTAATGGTTTGG - Intronic
999630888 5:153570102-153570124 ATCCACACTGATTCATGAAAAGG + Intronic
1000905887 5:166965097-166965119 ATCCTCACAGACGCATGGTAGGG - Intergenic
1002397388 5:178968723-178968745 CTTCTCAGGGATTCAAGGTAAGG - Intergenic
1005266895 6:24121576-24121598 ATTCTGAGTGCTGCATGGTATGG - Intergenic
1005551942 6:26929789-26929811 ACCCTCAGTGATTCAGTGCATGG + Intergenic
1006812285 6:36827656-36827678 GTCCTCAGTGGATCATGGTGAGG - Intronic
1007938364 6:45753968-45753990 TTCCTCAGAGAATGATGGTAGGG + Intergenic
1008073062 6:47117085-47117107 ATCCTCAGGAATTCATAGGAAGG - Intergenic
1008261846 6:49376072-49376094 ATGCCCAGTGATGCATGATATGG + Intergenic
1008359128 6:50593867-50593889 ATCCCCAAAGATTCATGGTAGGG + Intergenic
1009949249 6:70376551-70376573 ACCCTCTGTGACTCATGGAAAGG + Intergenic
1015444874 6:133291821-133291843 ATCCACATTGATTCATGTTTGGG + Intronic
1021372718 7:19869850-19869872 GTCCTCAGGGATTCATGGGAGGG - Intergenic
1024607104 7:51030968-51030990 ATCCTCAGATATTCCTGGAAAGG - Intronic
1027805383 7:82814850-82814872 ATTCTCACTGATTCCTGGTAGGG - Intronic
1028490919 7:91410836-91410858 ATCCTAAGTGATGCATGTCAGGG - Intergenic
1031122254 7:117735128-117735150 ATCCTCAGTGAGTTATGTTATGG + Intronic
1032464739 7:132136883-132136905 TTCCTCTGTGAATCATGGGAGGG + Intronic
1034735936 7:153429638-153429660 GTCCTCTGTGATTCATGAAAGGG - Intergenic
1035854119 8:2955394-2955416 ATCCTCAGTGTTTGATGCAATGG - Intronic
1038582094 8:28756739-28756761 ATCCTCACTGATCCATGGTCTGG + Intergenic
1045864651 8:106851463-106851485 ATCGTCAGTGATCCATGGACTGG + Intergenic
1047946923 8:129889536-129889558 AACCTTTGTGATTCATGGGAAGG + Intronic
1059056875 9:110992345-110992367 ATCCTCACTGACACTTGGTATGG - Intronic
1060324759 9:122603215-122603237 TTCCTCATTTATTCATGCTAAGG - Intergenic
1186916167 X:14224212-14224234 ATGCTCAGTGATTTATGCTCTGG + Intergenic
1189670394 X:43402232-43402254 ATCATCAGTGATCCATGGAAGGG + Intergenic
1196396744 X:115271815-115271837 ATCATCACGGAGTCATGGTAAGG - Intergenic