ID: 910367931

View in Genome Browser
Species Human (GRCh38)
Location 1:86486572-86486594
Sequence TGCTGCAGACAGTTGAGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910367925_910367931 12 Left 910367925 1:86486537-86486559 CCTCAATCGACTGAATCAAGCAG 0: 1
1: 0
2: 1
3: 6
4: 53
Right 910367931 1:86486572-86486594 TGCTGCAGACAGTTGAGCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 212
910367924_910367931 15 Left 910367924 1:86486534-86486556 CCGCCTCAATCGACTGAATCAAG 0: 1
1: 0
2: 2
3: 2
4: 91
Right 910367931 1:86486572-86486594 TGCTGCAGACAGTTGAGCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910367931 Original CRISPR TGCTGCAGACAGTTGAGCTG GGG Exonic
902186869 1:14731997-14732019 TGCTGCAGTGAGGTCAGCTGTGG + Intronic
902760611 1:18578446-18578468 TGCTGCAGAGTGCTGAGCAGAGG + Intergenic
903317740 1:22521783-22521805 TGCTACGGACAGGTGCGCTGGGG - Intronic
903994730 1:27298705-27298727 TGCTGCAGGCAGTAGGGCTGGGG - Intronic
904163470 1:28537771-28537793 TGCTACAGAAAGGTGGGCTGGGG + Intronic
906207756 1:43996193-43996215 AGCGGCAGACAGGTGCGCTGTGG - Exonic
906275580 1:44512881-44512903 TGGAGCAGCCAGTTGACCTGAGG + Intronic
906518597 1:46454002-46454024 TGCGACAGAGAGTGGAGCTGAGG + Intergenic
907332480 1:53680078-53680100 TTCAGCAGACATTTGGGCTGGGG - Intronic
908253411 1:62283099-62283121 TGCTGCAGACTGCAGAGCTGGGG - Intronic
908782405 1:67702967-67702989 TGTTGCAGACAGTTAAACTGTGG + Exonic
909134993 1:71786795-71786817 TGCTTCATACAGTAGAGTTGTGG + Intronic
910250608 1:85194805-85194827 TGCTGATGGCATTTGAGCTGGGG - Intronic
910367931 1:86486572-86486594 TGCTGCAGACAGTTGAGCTGGGG + Exonic
911793424 1:102047117-102047139 TGCTGCTGACAGAGGAGCAGTGG - Intergenic
913220753 1:116658533-116658555 TGCTGCAGTCAGTTGCCATGAGG - Intronic
918137390 1:181686517-181686539 TGCTGCAGGCAGATCACCTGAGG - Intronic
918976585 1:191494882-191494904 AGCTGAAGACACTTGAGCAGAGG + Intergenic
919991605 1:202711200-202711222 AGCTGCAGACAGTTAAGTGGTGG + Intergenic
920371232 1:205480720-205480742 TGCTGCAGCCAGGTGAGAAGAGG + Intergenic
922614775 1:226955273-226955295 TGCAGCAGACAGCTGCCCTGGGG + Intronic
1064128054 10:12681431-12681453 GGCTGCAGGCAGCTGCGCTGCGG - Intronic
1064498898 10:15946950-15946972 TGGTGCAGACATTTGAGGAGAGG + Intergenic
1069169539 10:65208674-65208696 TGCTCCAGTCAGTGGAGCTGGGG - Intergenic
1069727619 10:70591285-70591307 TGCTGTGGTCAGCTGAGCTGTGG + Intergenic
1070282982 10:75063339-75063361 TGCTGCAGTGACTTGAGCTGAGG - Intergenic
1076134074 10:128032674-128032696 GGCACCAGCCAGTTGAGCTGCGG + Intronic
1076615516 10:131751836-131751858 AGCTGCAGACAGCGGGGCTGTGG + Intergenic
1077496305 11:2888186-2888208 TGCTGCAGAGAGCAGAACTGCGG + Exonic
1078222392 11:9362722-9362744 TGCCCCAGAGGGTTGAGCTGGGG + Intergenic
1079543417 11:21603579-21603601 TACTGCATACACTTGAGCTTGGG + Intergenic
1081606931 11:44532921-44532943 TGCTGAAGACAGTAGGACTGAGG - Intergenic
1084102170 11:66957099-66957121 TGATGCAAACACTTGTGCTGGGG - Intronic
1084233517 11:67770553-67770575 TGAGGCAGACAGATGACCTGAGG + Intergenic
1085124585 11:73991187-73991209 TGCTGCTGACAGGTGAACTCTGG - Intergenic
1086523327 11:87697153-87697175 TGCGGCTGACACTTGAGCAGAGG - Intergenic
1092708963 12:11314089-11314111 GGCTGCAGACACTTGACCTTAGG - Intergenic
1093075315 12:14752167-14752189 TGCTGAAGTCAGTGGAGGTGTGG - Intergenic
1094189241 12:27680269-27680291 TGCTGCTGACACTTTAGCTCTGG - Intronic
1096111664 12:49032433-49032455 AGCTGCAGAGAGCTGGGCTGAGG + Exonic
1100739032 12:97570839-97570861 TTATGCAGACAGTGCAGCTGAGG + Intergenic
1101347732 12:103901872-103901894 AGCTTCAGACAGCTGAGGTGGGG + Intergenic
1101881498 12:108629039-108629061 CGCTGCAGGCAGATGAGCAGAGG + Intronic
1103547654 12:121713221-121713243 CGCTGCAGAAAGTTGGTCTGTGG + Intronic
1103937806 12:124485811-124485833 TGCTGGAGACGGCTGAGGTGTGG - Intronic
1104915568 12:132262682-132262704 AGGTGCAGACAGATGAGCTATGG - Intronic
1104915584 12:132262759-132262781 AGGTGCAGACAGATGAGCTATGG - Intronic
1106518517 13:30475948-30475970 CCCTGCAGACATTTGAGTTGGGG + Intronic
1107351773 13:39522258-39522280 TTTTGCAGACAGATAAGCTGAGG + Intronic
1111927733 13:94481084-94481106 TGTGGCAGACATTGGAGCTGCGG - Intergenic
1113560734 13:111278637-111278659 TGCTGAAGAGAGGTGATCTGTGG + Intronic
1117111053 14:52454912-52454934 TGCTGCAGACAGTTATTGTGAGG - Intronic
1117446317 14:55806904-55806926 TGCTGCAGACAACATAGCTGAGG + Intergenic
1118842593 14:69524306-69524328 TGCAGCAGACACTGGAGGTGAGG + Exonic
1119406887 14:74404665-74404687 TGCTGCAGGCAACTGAGCTCAGG + Intergenic
1119463493 14:74832703-74832725 TGCAGCAGACAGATCACCTGAGG - Intronic
1120579574 14:86229610-86229632 TGCCACAGAAAGATGAGCTGAGG - Intergenic
1122134156 14:99623093-99623115 TCCTGCAGGCAGCAGAGCTGGGG + Intergenic
1124268823 15:28262266-28262288 TGCTGCAGGAAGTTGGGGTGGGG - Intronic
1124345254 15:28917982-28918004 AGCAGCAGGCAGCTGAGCTGGGG - Intronic
1124395634 15:29299424-29299446 TGCTGCAGCCACGTGACCTGGGG - Intronic
1126977859 15:54205620-54205642 TGCTCCAGACAGCAGAACTGGGG - Intronic
1127367727 15:58307240-58307262 TTCTGCAGACAGTAAAGCTGGGG - Intronic
1128614286 15:69097213-69097235 TGGTGCAGTCAGGTGAGCTTGGG - Intergenic
1128745269 15:70110064-70110086 GGCTGCAGGCAGGTGGGCTGGGG - Intergenic
1129412807 15:75359243-75359265 TGCTCCAGACAGGGGAGCTCAGG + Intronic
1130919891 15:88335164-88335186 TGCTTCTGAGAGTTGAGCAGAGG + Intergenic
1135265660 16:21023615-21023637 TGCTGGAGACTGCTAAGCTGAGG + Intronic
1135640195 16:24113053-24113075 TGCGGCAGAAATTTGAGGTGAGG + Exonic
1135873001 16:26169527-26169549 TTATGCAGAGAGATGAGCTGGGG + Intergenic
1137505811 16:49052867-49052889 TGCTGCAGCCAGAGAAGCTGTGG + Intergenic
1138294161 16:55872470-55872492 AGCTGCTCACAGTTGAGCTGGGG - Intronic
1138578274 16:57922807-57922829 AGCTGCAGACAGTAGGCCTGGGG - Intronic
1138750372 16:59412399-59412421 TGCTGCAGACAGCAGAGATCTGG - Intergenic
1140481010 16:75262922-75262944 GGCTGCAGCCTGTTGAGCGGTGG - Intronic
1141874575 16:86814137-86814159 TGCTGCAAACACATGAGCAGTGG - Intergenic
1142173172 16:88633458-88633480 TGCTCCTGGCCGTTGAGCTGTGG - Intergenic
1203139458 16_KI270728v1_random:1751283-1751305 TGAGGCAGACAGATCAGCTGAGG + Intergenic
1143468178 17:7152541-7152563 TGCTGTAGACATTTGTGTTGGGG - Intergenic
1144721665 17:17475471-17475493 TGCTGCAGAGAGCTGTGCTGAGG + Intergenic
1145387623 17:22427535-22427557 TGATGCAGACAGATCACCTGAGG - Intergenic
1147559831 17:41501876-41501898 TGCTGCTGTCCCTTGAGCTGGGG - Intronic
1151233974 17:72705003-72705025 TGCTGAAGAGAGCAGAGCTGAGG + Intronic
1152739310 17:82012063-82012085 TGCTGCAGAAACTCCAGCTGAGG - Intronic
1155959958 18:31985855-31985877 TGATGCAGGCAGATGACCTGAGG + Intergenic
1156036321 18:32770933-32770955 TGCTGCCAACAGCCGAGCTGAGG - Exonic
1157393188 18:47320162-47320184 TGCTGCAGACAGTTGAAAAAAGG - Intergenic
1159979525 18:74760579-74760601 TGCTACTGACAGTTGCCCTGAGG + Intronic
1160425501 18:78776270-78776292 AGCTGGAGACAGATGAGCTCAGG - Intergenic
1160620554 18:80167585-80167607 CGCTGCAGAGGGTGGAGCTGGGG + Intronic
1160748812 19:724062-724084 GGCTGCAGACAGATGAGGAGAGG + Intronic
1162436492 19:10663099-10663121 TGCTGAAGACAGGTGTGTTGGGG + Intronic
1163372472 19:16909064-16909086 TGCTGGAATCAGATGAGCTGGGG - Intronic
1163798134 19:19348883-19348905 TCCAGCAGACTGTAGAGCTGCGG - Exonic
1166067736 19:40370017-40370039 TGCTGCAGAGCGGTGAGCTGGGG + Exonic
1166785396 19:45364118-45364140 TCCTGCGGAGAGATGAGCTGGGG + Exonic
925181335 2:1818947-1818969 TGGTGCAGAAAGTGCAGCTGTGG + Intronic
925389365 2:3484898-3484920 CGGTGTAGACACTTGAGCTGTGG - Intronic
926800962 2:16660292-16660314 TGCAGCTGACAGCTGAGCTTAGG + Intronic
927766037 2:25809212-25809234 TTCTGCAGGCAGTTGAGAGGGGG + Intronic
929944789 2:46362104-46362126 TGCTGCAGAAAGCTGAGGTCAGG - Intronic
930109030 2:47662485-47662507 AGCTTCAGAGAGTTGACCTGGGG - Intergenic
931640080 2:64374327-64374349 TGCTGCAGAAAGCAGAGTTGGGG + Intergenic
934979133 2:98825907-98825929 AGCTGGAGACAGTTGGGCTAGGG - Intronic
935824848 2:106935639-106935661 TGTTGAAGACTGTTGACCTGGGG + Intergenic
937220619 2:120341308-120341330 TGGGGCAGACAGAGGAGCTGAGG - Intergenic
938158025 2:128958067-128958089 TGCAGCAGCCAGGTGTGCTGTGG - Intergenic
938837835 2:135125836-135125858 AGCTGCAGAAAGTGAAGCTGTGG + Intronic
944342098 2:198613470-198613492 TGCTGCAGACAACAGAGATGTGG + Intergenic
945254518 2:207792311-207792333 TCCAGCTCACAGTTGAGCTGTGG - Intergenic
945308516 2:208283641-208283663 GGCTGCAGTGAGCTGAGCTGTGG - Intronic
947621514 2:231594030-231594052 TGCTGGAGACAGTGGAGCAGAGG + Exonic
948080990 2:235205019-235205041 TGCTGCAGAGTGGGGAGCTGAGG - Intergenic
1169560966 20:6800344-6800366 TTCTGCAGACAGTTTATGTGTGG - Intergenic
1169936679 20:10891154-10891176 TGAGGCAGACAGATGACCTGAGG - Intergenic
1170594059 20:17792340-17792362 TGAGGCAGGCAGCTGAGCTGAGG + Intergenic
1171184125 20:23112652-23112674 AGCTGGAGACATCTGAGCTGTGG - Intergenic
1171224847 20:23433816-23433838 GGCTGAAGACACTTGAGCTCAGG - Intergenic
1171271127 20:23818182-23818204 AGCTGCAGACCGTTGTGGTGAGG - Intergenic
1171273412 20:23834397-23834419 TCCTGCAGGCAGGTGAGCTCTGG + Intergenic
1172100795 20:32483264-32483286 TGCCGCCGGCCGTTGAGCTGCGG - Intronic
1173151271 20:40568291-40568313 TGCTGCAGACAGGTGAAGTCAGG - Intergenic
1174055126 20:47793403-47793425 AGCTGCAGATAGTTAAGATGAGG + Intergenic
1175646123 20:60673328-60673350 GGCTGTAGACAGTGGTGCTGAGG - Intergenic
1176428727 21:6563658-6563680 TTCTGCAGTCAGTGGGGCTGGGG + Intergenic
1178723272 21:35028948-35028970 CACTGCAGACAGATGAGCTAGGG - Intronic
1179163985 21:38920823-38920845 GGCTGCAAACAGATGAGCTAGGG + Intergenic
1179391072 21:40991835-40991857 TGCTGCAACAAGTTGAGCTAAGG - Intergenic
1179704217 21:43171974-43171996 TTCTGCAGTCAGTGGGGCTGGGG + Intronic
1180617107 22:17135529-17135551 TGCTGCAGCCACCTAAGCTGGGG + Intergenic
1181465941 22:23110637-23110659 AGCTGCTGACCCTTGAGCTGGGG - Intronic
1181604320 22:23971141-23971163 TCCTGCAGACTGCTGACCTGAGG - Intronic
1183038612 22:35159402-35159424 TGCTGCACAGAGTGGAGCTGAGG - Intergenic
1183163852 22:36132663-36132685 GGCAGCAGGCAGTGGAGCTGAGG + Intergenic
1183170127 22:36181572-36181594 GGCAGCAGGCAGTGGAGCTGAGG + Intergenic
1183686956 22:39366682-39366704 TGGTGCAGGCAGTGGAGATGGGG - Intronic
1185168386 22:49276500-49276522 TGATGCACACACTTCAGCTGGGG - Intergenic
950838007 3:15939204-15939226 CACTGCAGACAGTGGAACTGTGG + Intergenic
951084125 3:18490764-18490786 TGCTTCATACAATTGAGCTTTGG - Intergenic
951453517 3:22865459-22865481 TGAGGCAGACAGTTCACCTGAGG + Intergenic
953658381 3:44871969-44871991 TGCTTCAGACACTTGACCTGTGG + Intronic
954803983 3:53204686-53204708 CTCTGCAGTCAGTAGAGCTGGGG - Intergenic
956158914 3:66326859-66326881 TGCTGCTGACAGGTGAACTCTGG + Intronic
956882927 3:73529379-73529401 GGCTGCAAACAGGTGACCTGAGG + Intronic
958019791 3:87981105-87981127 TGCTGCAAACAGACCAGCTGTGG - Intergenic
959672153 3:108990807-108990829 TGCTGCTGACAGTGGTGATGGGG + Intronic
959704546 3:109327898-109327920 TGCTGCTGACAGGTGAACTCTGG - Exonic
960175937 3:114517918-114517940 TGCTGAAGATAGTAGAACTGTGG + Intronic
962916137 3:139905676-139905698 TGCTGCAGAGAGGTCAGCTAAGG - Intergenic
964445263 3:156751551-156751573 TGCTGGAGACAGTTTGGCAGCGG + Intergenic
967861711 3:194157035-194157057 TACTGAAGACACGTGAGCTGAGG - Intergenic
968134540 3:196211468-196211490 GGCTGCAGACAGTTCTGCTGAGG - Intronic
969868958 4:10093130-10093152 TGCTGGAGACAGGCCAGCTGGGG - Intronic
976301973 4:83523885-83523907 TTCTGCAGACATGTGAGCTCAGG + Intergenic
978870279 4:113567398-113567420 TGCGGCAGGCAGATCAGCTGAGG - Intronic
979881130 4:125961718-125961740 TGCTGCTGTCTGTTGGGCTGTGG + Intergenic
982526470 4:156485148-156485170 GACTGGTGACAGTTGAGCTGAGG + Intergenic
983931006 4:173453337-173453359 TGCTGGAGACAGTTGTCCGGAGG - Intergenic
984596004 4:181668661-181668683 TGTTGCAGGTAGTTGAGATGAGG - Intergenic
985829957 5:2220917-2220939 AGGTGAAGACACTTGAGCTGGGG - Intergenic
986332534 5:6727834-6727856 TGATACAGACAGCAGAGCTGTGG - Intronic
991464746 5:66898874-66898896 TGCTGGAGTAAGTTGTGCTGTGG + Intronic
992129843 5:73681261-73681283 TGCAGCAGACATTTAAGGTGAGG + Intronic
993469236 5:88286475-88286497 TGCTTCAGTAAGTTGAGCAGAGG - Intergenic
997098494 5:130941153-130941175 TGCTGCAAAAAGTTGCCCTGAGG + Intergenic
997858013 5:137390790-137390812 TGGTTCAGACAGTTGACCTCTGG - Intronic
997944475 5:138187320-138187342 GGCTGCAGTCTGTTGAGCTTTGG - Exonic
998411379 5:141914200-141914222 TGATGCAGGCAGTGGAGCTGCGG + Intergenic
998536768 5:142940158-142940180 AGCCGCAGACTGGTGAGCTGAGG - Intronic
999094576 5:148966520-148966542 GGCTGCAGACAGCTCAGCTTGGG + Intronic
999987698 5:157020589-157020611 TGCTGTGGACAGCTGAGATGGGG - Intergenic
1001490560 5:172151824-172151846 TGCTGCAGACAGTCTAGCCTCGG + Intronic
1001592213 5:172873379-172873401 TGCAACAGACAGATGAGCTCAGG - Intronic
1001674295 5:173499524-173499546 GCCTCCAGGCAGTTGAGCTGAGG + Intergenic
1002322937 5:178386539-178386561 TGCTTCAGCCTGTTGAGATGAGG + Intronic
1002419812 5:179139652-179139674 GGCTGCAGGCAGGTGGGCTGTGG + Intronic
1003045569 6:2730098-2730120 TGCTGCAGGCAGATGGCCTGCGG - Intronic
1003104372 6:3203388-3203410 TGCTGCAGACATTTGAGCTCTGG + Intergenic
1003505651 6:6738014-6738036 TGCTGAAGGATGTTGAGCTGGGG - Intergenic
1004286938 6:14329922-14329944 TGCGGCACACAGTTTAACTGGGG + Intergenic
1005248852 6:23920703-23920725 TGCGGCAGAAAGATCAGCTGGGG + Intergenic
1006444168 6:34069584-34069606 GGCTGGAGACTGATGAGCTGGGG - Intronic
1006470462 6:34225949-34225971 TGTTGCAGACAGGTGAGATAAGG - Intergenic
1007473299 6:42104452-42104474 AGCTGCCGGCAGGTGAGCTGCGG - Exonic
1012552529 6:100477147-100477169 CGCTGCAGAATTTTGAGCTGAGG + Intergenic
1015751743 6:136566966-136566988 TGCTGCCTACAGTTGACATGTGG - Intronic
1016436281 6:144041055-144041077 TTTTGCAGACATATGAGCTGAGG + Intronic
1017886564 6:158604524-158604546 TGCTGCTGACAGCAGAGCAGAGG - Intronic
1019301073 7:303827-303849 TGCTGGGGACAGTTGAAGTGGGG + Intergenic
1019301095 7:303920-303942 TGCTGGGGACAGTTGAGGTGGGG + Intergenic
1019458140 7:1142563-1142585 TTTTGCAGATAGTTGTGCTGTGG - Intergenic
1020087726 7:5320548-5320570 TGCTCCAGACAGTAGATGTGGGG + Exonic
1020165116 7:5801593-5801615 TGCGGCAGACAGCTCACCTGAGG - Intergenic
1022406340 7:30093748-30093770 TGCGGCAGGCAGCTGAGCTTAGG - Intronic
1023544054 7:41298433-41298455 ATCTGCAGACAGTAGAGCTGAGG - Intergenic
1025665350 7:63580310-63580332 TGCTCCAGACAGTAGATGTGGGG + Intergenic
1026539779 7:71269583-71269605 CTCTGCAGACAGATGAGCAGTGG - Intronic
1029202455 7:98848159-98848181 TGCTGCTGCCAGATGTGCTGTGG - Exonic
1030152076 7:106417532-106417554 TGCTGAGGACAGTTGAGATGAGG + Intergenic
1030331136 7:108271857-108271879 TGCTGAAAACTGTTGGGCTGGGG + Intronic
1032617042 7:133484273-133484295 TGCTGTTGGCAGTTGGGCTGCGG + Intronic
1034965819 7:155390043-155390065 TAATGCAGTGAGTTGAGCTGTGG - Intronic
1035110673 7:156478892-156478914 TGCAGCACACAGGTCAGCTGTGG - Intergenic
1035123058 7:156585182-156585204 TGCTGGAGTCAGCTGAGCCGGGG + Intergenic
1035286825 7:157812123-157812145 TGGTGCACACAGGTGAGCAGAGG + Intronic
1036691466 8:10947393-10947415 AGATGCAGACAGTGGAGTTGAGG + Intronic
1036841672 8:12128091-12128113 TGCTGAAGACAATTGAATTGTGG - Intergenic
1038646378 8:29365715-29365737 TCCTGCAGACAATTGGGCTATGG - Intergenic
1039913567 8:41843531-41843553 TGGTGCAGACAGGGCAGCTGGGG + Intronic
1040280761 8:46040904-46040926 TGCTGCAGAGAACTGAGATGAGG - Intergenic
1044819702 8:96147281-96147303 TGCTGCAGGCAGTTGATTTATGG + Intronic
1046823523 8:118661726-118661748 CACTGCAGAAGGTTGAGCTGAGG + Intergenic
1047190499 8:122674824-122674846 TGCTGCTCACAGTGGAGCAGAGG - Intergenic
1047568544 8:126073115-126073137 TGCTGCAGACACTTGCTCAGTGG + Intergenic
1048688250 8:136928581-136928603 TCCAGCTGACAGTTCAGCTGAGG - Intergenic
1049246218 8:141563986-141564008 TGCTGTAGCCAGCTGAGGTGTGG + Intergenic
1049993812 9:1015856-1015878 TCTTCCAGGCAGTTGAGCTGAGG + Intergenic
1051720254 9:20029476-20029498 TGCTGCAGTCAGATGGACTGAGG - Intergenic
1052447211 9:28578262-28578284 TGCTGCATGGAGTTGAGGTGGGG + Intronic
1052487552 9:29121171-29121193 TGATGCACACAGATGAGCTGAGG + Intergenic
1052582277 9:30373595-30373617 TGCTGCTGACAGGTGATTTGAGG - Intergenic
1060153288 9:121302108-121302130 TCCTGAAGACAGTGCAGCTGAGG + Exonic
1060820775 9:126660460-126660482 TGCTGCAGCCAGGTGGCCTGGGG + Intronic
1062322237 9:135995971-135995993 TGCTGACGCCAGGTGAGCTGTGG + Intergenic
1062483928 9:136764890-136764912 AGCTGCAGAGAGCTGGGCTGGGG + Intronic
1187295269 X:17993257-17993279 TGCTGCTGAGAGCTGAGATGAGG - Intergenic
1189485655 X:41429517-41429539 TTCTGCTCACTGTTGAGCTGTGG + Intergenic
1196344003 X:114630779-114630801 TGCTGTAGACAGCAGAGCTGGGG - Intronic
1196757394 X:119170045-119170067 TGTTGGAGACAATTTAGCTGTGG - Intergenic
1197179576 X:123519973-123519995 TGCTGCTGACAGTGCTGCTGGGG - Intergenic
1197884915 X:131208559-131208581 TGCTGAAGACTGTTGAGGGGAGG + Intergenic
1199851776 X:151729041-151729063 TGCTGGGGACAGAGGAGCTGGGG + Intergenic
1201107384 Y:10773266-10773288 TGCTGCAGACAGTAGTGGAGAGG - Intergenic