ID: 910368839

View in Genome Browser
Species Human (GRCh38)
Location 1:86494585-86494607
Sequence ATGTAGGAATTGTGGGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1012
Summary {0: 1, 1: 0, 2: 2, 3: 147, 4: 862}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910368839_910368847 13 Left 910368839 1:86494585-86494607 CCATTTCCCCACAATTCCTACAT 0: 1
1: 0
2: 2
3: 147
4: 862
Right 910368847 1:86494621-86494643 AAAACATGAGGGCTTCTGCAAGG 0: 1
1: 0
2: 2
3: 24
4: 382
910368839_910368845 1 Left 910368839 1:86494585-86494607 CCATTTCCCCACAATTCCTACAT 0: 1
1: 0
2: 2
3: 147
4: 862
Right 910368845 1:86494609-86494631 TCAAAATGCTGGAAAACATGAGG 0: 1
1: 0
2: 4
3: 38
4: 396
910368839_910368843 -10 Left 910368839 1:86494585-86494607 CCATTTCCCCACAATTCCTACAT 0: 1
1: 0
2: 2
3: 147
4: 862
Right 910368843 1:86494598-86494620 ATTCCTACATTTCAAAATGCTGG 0: 1
1: 0
2: 0
3: 24
4: 309
910368839_910368846 2 Left 910368839 1:86494585-86494607 CCATTTCCCCACAATTCCTACAT 0: 1
1: 0
2: 2
3: 147
4: 862
Right 910368846 1:86494610-86494632 CAAAATGCTGGAAAACATGAGGG 0: 1
1: 0
2: 1
3: 40
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910368839 Original CRISPR ATGTAGGAATTGTGGGGAAA TGG (reversed) Intronic
900512208 1:3066165-3066187 ATGTAGGCCCAGTGGGGAAAAGG - Intergenic
900841037 1:5048777-5048799 AAGAAGGAAATGTGGGGAAATGG - Intergenic
900847736 1:5117053-5117075 AAGAAGGAAATTTGGGGAAATGG - Intergenic
901128696 1:6948584-6948606 ATGTTGGCATGGTGGGGACAGGG + Intronic
901182465 1:7351099-7351121 ACCTAGGAATTGTGGGGACTAGG + Intronic
902469871 1:16641647-16641669 GTGTAGGGCTTGTGGGGAGATGG + Intergenic
902970118 1:20042317-20042339 AAGAAGGAAATATGGGGAAATGG + Intronic
903395731 1:23000577-23000599 AAGAAGGAAATATGGGGAAATGG + Intergenic
904394199 1:30207163-30207185 AAGAAGGAAATATGGGGAAATGG - Intergenic
904711887 1:32436266-32436288 AAGAAGGAAATATGGGGAAATGG - Intergenic
904764405 1:32832573-32832595 ATGTAGGAATACTGGGCAATGGG - Intronic
904996232 1:34633739-34633761 AGGAAGGAAATATGGGGAAATGG + Intergenic
905060233 1:35133889-35133911 AAGAAGGAAATATGGGGAAATGG + Intergenic
905429533 1:37911422-37911444 AAGAAGGAAATATGGGGAAATGG - Intronic
905530052 1:38670867-38670889 ATAGAGGAAGGGTGGGGAAATGG - Intergenic
905692264 1:39952177-39952199 ATGTGGGGATTGTGGGGGTATGG + Intergenic
906081174 1:43089433-43089455 AAGAAGGAAATATGGGGAAATGG - Intergenic
906378997 1:45319626-45319648 AAGAAGGAAATATGGGGAAATGG - Intergenic
906744263 1:48210764-48210786 AAGAAGGAAATATGGGGAAATGG + Intergenic
906797833 1:48711732-48711754 AGGGAGAAATTATGGGGAAAGGG - Intronic
906992783 1:50756354-50756376 ATGAAGAACTTGTTGGGAAATGG - Intronic
906996522 1:50800870-50800892 ATGTTTGAATTGAGAGGAAAGGG + Intronic
907164816 1:52401064-52401086 ATGGATGAATTTGGGGGAAAGGG - Intronic
907503317 1:54899650-54899672 AAGAAGGAAATATGGGGAAATGG + Intergenic
907521516 1:55026525-55026547 AAGAAGGAAATATGGGGAAATGG - Intergenic
907710093 1:56872537-56872559 GGGTATGAATTGTGGGAAAAAGG + Intronic
908148913 1:61279190-61279212 ATGTTGGTATTGTGGGGTGAAGG + Intronic
908263081 1:62353691-62353713 ATGGTGGAATGGGGGGGAAAGGG + Intergenic
908461459 1:64351746-64351768 AAGAAGGAAATTTGGGGAAACGG + Intergenic
908852661 1:68390191-68390213 AAGAAGGAAATATGGGGAAATGG - Intergenic
908896216 1:68903188-68903210 AAGTAGGGAGTGTGGAGAAAGGG + Intergenic
909035723 1:70592220-70592242 AAGAAGGAAATATGGGGAAATGG - Intergenic
909223408 1:72989594-72989616 ATGAAGGAAATTTGGGGAAATGG + Intergenic
909910216 1:81249371-81249393 AAGAAGGAAATTTGGGGAAATGG - Intergenic
909978196 1:82069305-82069327 AAGAAGGAAATATGGGGAAATGG + Intergenic
910049643 1:82959262-82959284 AAGAAGGAAATATGGGGAAACGG - Intergenic
910368839 1:86494585-86494607 ATGTAGGAATTGTGGGGAAATGG - Intronic
910705915 1:90129455-90129477 ATGTAGGGACTGGGGTGAAATGG + Intergenic
911071425 1:93834912-93834934 AAGAAGGAAATATGGGGAAATGG - Intronic
911510346 1:98802831-98802853 AAGAAGGAAATATGGGGAAATGG + Intergenic
911570637 1:99513550-99513572 AAGAAGGAAATTTGGGGAAATGG - Intergenic
911744921 1:101430896-101430918 ATGTTGGAGGTGTGGGGAGAGGG - Intergenic
911759522 1:101599826-101599848 AAGAAGGAAATATGGGGAAATGG + Intergenic
912296719 1:108476865-108476887 AAGAAGGAAATGTGGGGAAATGG - Intergenic
912687052 1:111775968-111775990 AGGCAGAAATAGTGGGGAAAGGG + Exonic
912813828 1:112813365-112813387 AAGAAGGAAATATGGGGAAATGG - Intergenic
913220770 1:116658636-116658658 CTGTTGGAATTGTGGGGTAGAGG - Intronic
913245441 1:116866408-116866430 AAGAAGGAAATATGGGGAAATGG - Intergenic
914339824 1:146750458-146750480 AAGTAGGAAATATGGGGGAAGGG - Intergenic
914907088 1:151755467-151755489 AACAAGGAAGTGTGGGGAAAAGG + Intergenic
916399123 1:164426604-164426626 GTGTATAAATTGTGGGGACAGGG + Intergenic
918347369 1:183617572-183617594 AAGAAGGAAATTTGGGGAAATGG - Intergenic
918406435 1:184215599-184215621 TTCTAGGAAATGTGTGGAAAAGG - Intergenic
918473671 1:184900679-184900701 AAGGAGGAATAGAGGGGAAAGGG + Intronic
918556519 1:185806846-185806868 ATGTAGGCATTATGTGGAGAAGG + Intronic
918567413 1:185950077-185950099 AAGAAGGAAATTTGGGGAAATGG + Intronic
918714145 1:187767295-187767317 AAGAAGGAAATATGGGGAAATGG + Intergenic
919476648 1:198038661-198038683 AAGAAGGAAATGTGGGGAAATGG - Intergenic
919610764 1:199742935-199742957 ATTTAGTAATTGTGGATAAATGG - Intergenic
920303251 1:205002491-205002513 AGGTAGAAAGTGTGGGGGAAGGG - Intronic
920908305 1:210191414-210191436 AAGAAGGAAATATGGGGAAATGG - Intergenic
921205395 1:212844480-212844502 AAGAAGGAAATATGGGGAAATGG - Intronic
921459522 1:215411728-215411750 AAGAAGGAAATTTGGGGAAATGG + Intergenic
921509510 1:216011921-216011943 AAGAAGGAAATATGGGGAAATGG - Intronic
921732723 1:218595585-218595607 AAGAAGGAAATATGGGGAAATGG + Intergenic
921962961 1:221055385-221055407 ATGTAGGTTTGGTAGGGAAAAGG - Intergenic
922048661 1:221969865-221969887 AAGAAGGAAATGTGGGGAAATGG - Intergenic
922049284 1:221974886-221974908 AAGAAGGAAATTTGGGGAAATGG + Intergenic
922153810 1:223026187-223026209 AAGAAGGAAATTTGGGGAAATGG + Intergenic
922363287 1:224842247-224842269 AAGAAGGAAATATGGGGAAATGG + Intergenic
922906647 1:229178359-229178381 AAGAAGGAAATCTGGGGAAATGG - Intergenic
922916125 1:229259212-229259234 CTGTAGGAATTGTTGGGTATTGG - Intergenic
923139113 1:231146096-231146118 ATGTTGAAAATGTGGAGAAAAGG + Intergenic
923213944 1:231831990-231832012 AAGAAGGAAATATGGGGAAATGG + Intronic
923257084 1:232231413-232231435 AAGAAGGAAATTTGGGGAAATGG + Intergenic
923408377 1:233685217-233685239 AAGAAGGAAATATGGGGAAATGG + Intergenic
923963040 1:239105289-239105311 AAGAAGGAAATATGGGGAAATGG - Intergenic
923982859 1:239345287-239345309 AAATGGGAAATGTGGGGAAATGG + Intergenic
924180950 1:241438109-241438131 AAGAAGGAAATGTGGGGAAATGG - Intergenic
924673696 1:246153890-246153912 AGGTTGGAAATTTGGGGAAATGG - Intronic
924794247 1:247281170-247281192 AAGAATGAAGTGTGGGGAAATGG + Intergenic
924895928 1:248338016-248338038 AAGAAGGAAATATGGGGAAATGG + Intergenic
1062931039 10:1352868-1352890 AAGAAGGAAATATGGGGAAATGG - Intronic
1063509340 10:6631379-6631401 AAGAAGGAAATTTGGGGAAACGG + Intergenic
1064308923 10:14194287-14194309 ATGCTGGCATTGTGGGGAAAGGG + Intronic
1064831120 10:19467564-19467586 ACTTAGGAATTTTGGGGGAAAGG + Intronic
1065442872 10:25770532-25770554 AAGAAGGAAATATGGGGAAATGG + Intergenic
1066103149 10:32135604-32135626 AAGAAGGAAATATGGGGAAATGG + Intergenic
1066436894 10:35403915-35403937 AAGAAGGAAATATGGGGAAATGG + Intronic
1067172977 10:43922742-43922764 ATGTAGGAATTGTGGGGTGCAGG - Intergenic
1067185508 10:44023999-44024021 ACATAGGAATTTGGGGGAAAAGG - Intergenic
1068058094 10:52035547-52035569 AAGAAGGAAATTTGGGGAAATGG + Intronic
1068107165 10:52632869-52632891 TTGTAGGCATTGTGAGGAGAGGG - Intergenic
1068179366 10:53500604-53500626 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1068231222 10:54170684-54170706 AAGAAGGAAATTTGGGGAAATGG - Intronic
1068487450 10:57678115-57678137 ATGTAGAACTTGTTGGGAACTGG - Intergenic
1068592084 10:58862797-58862819 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1068933325 10:62613153-62613175 AAGTAGAAATTCTGGGCAAAAGG - Intronic
1069584950 10:69593328-69593350 AGCTAGGAATAGTGGGGAGATGG + Intergenic
1070661100 10:78305823-78305845 GAGTTGGAATTGTGGGGAAGGGG - Intergenic
1071821996 10:89288595-89288617 AAGAAGGAAATATGGGGAAATGG - Intronic
1071849544 10:89554654-89554676 ATGTGTGTGTTGTGGGGAAACGG + Intronic
1071916456 10:90298920-90298942 AAGAAGGAAATATGGGGAAATGG - Intergenic
1071961383 10:90811435-90811457 GAGAAGGAAATGTGGGGAAATGG - Intronic
1072558250 10:96542279-96542301 ATGAAGGAATACTGGGGGAAGGG - Intronic
1072884739 10:99263134-99263156 AAGAAGGAAATATGGGGAAATGG - Intergenic
1072901249 10:99408798-99408820 ATGTAGGAATAGTGGTTGAAAGG + Intronic
1073014312 10:100385828-100385850 AAGAAGGAAATATGGGGAAATGG - Intergenic
1073683761 10:105731144-105731166 AAGAAGGAAATATGGGGAAATGG - Intergenic
1073709233 10:106019412-106019434 AAGAAGGAAATATGGGGAAATGG + Intergenic
1073869268 10:107843836-107843858 ATTTAGTATTTGTGGGGAGAAGG - Intergenic
1074741061 10:116484739-116484761 AAGAAGGAAATATGGGGAAATGG - Intergenic
1075093019 10:119453925-119453947 ATGGAGGAAATGCGGGGGAAGGG + Intronic
1075248958 10:120848764-120848786 AAGAAGGAAATATGGGGAAATGG - Intergenic
1076285103 10:129287822-129287844 ATGTGGGGAAGGTGGGGAAAGGG + Intergenic
1077588494 11:3473070-3473092 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1077612448 11:3651861-3651883 AAGAAGGAAATATGGGGAAATGG - Intronic
1077678820 11:4221057-4221079 AAGAAGGAAATATGGGGAAATGG + Intergenic
1077688255 11:4317697-4317719 AAGAAGGAAATATGGGGAAATGG + Intergenic
1077743327 11:4872411-4872433 ATGTGGGAATTAAGGGGCAAGGG + Intronic
1077766131 11:5162066-5162088 AAGAAGGAAATATGGGGAAATGG + Intronic
1077850544 11:6071623-6071645 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1078045886 11:7913948-7913970 AAGAAGGAAATCTGGGGAAATGG + Intergenic
1079447717 11:20571720-20571742 AAGAAGGAAATATGGGGAAATGG - Intergenic
1079672312 11:23185723-23185745 AAGAAGGAAATATGGGGAAATGG + Intergenic
1080027657 11:27630865-27630887 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1080798612 11:35588978-35589000 ATGGAGGGAGTGTGGTGAAATGG + Intergenic
1081160016 11:39738702-39738724 AAGAAGGAAATATGGGGAAATGG - Intergenic
1081694577 11:45101095-45101117 GTGCAAGAAGTGTGGGGAAAGGG - Intronic
1081888255 11:46517985-46518007 ATTTAGGGAATGTGGGTAAAGGG + Intronic
1083534664 11:63456837-63456859 AAGAAGGAAATATGGGGAAATGG - Intergenic
1084232556 11:67763590-67763612 AAGAAGGAAATATGGGGAAATGG - Intergenic
1084244197 11:67844699-67844721 AAGAAGGAAATGTGGGGACATGG + Intergenic
1084354507 11:68628443-68628465 AAGAAGGCAATGTGGGGAAATGG - Intergenic
1084828493 11:71749864-71749886 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1085336537 11:75701014-75701036 ATGTTGGAGTGCTGGGGAAATGG + Intergenic
1085430034 11:76439898-76439920 ATGTTGGATGTGTGGGGAAAAGG + Intergenic
1085703899 11:78769009-78769031 CTTTAGGAAATGTGGGGAAAGGG - Intronic
1085934529 11:81125716-81125738 AAGAAGGAAATATGGGGAAATGG - Intergenic
1086005272 11:82029144-82029166 AAGAAAGAAATGTGGGGAAATGG - Intergenic
1086032448 11:82376439-82376461 ATGTGGGAAGTGATGGGAAATGG + Intergenic
1086134546 11:83433186-83433208 AAGAAGGAAATATGGGGAAATGG + Intergenic
1086537437 11:87865115-87865137 ATGGAGGAAATGGGGGAAAAGGG + Intergenic
1087099342 11:94349641-94349663 AAGAAGGAAATATGGGGAAATGG - Intergenic
1087099917 11:94353767-94353789 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1087197168 11:95313438-95313460 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1087314930 11:96591854-96591876 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1087592477 11:100208662-100208684 ATGTAAAAATTGTGGGCAGATGG - Intronic
1087839251 11:102905659-102905681 AAGAAGGAAATATGGGGAAATGG + Intergenic
1088555238 11:111054327-111054349 AAGAAGGAAATATGGGGAAATGG - Intergenic
1088915382 11:114223845-114223867 ATGAAGGAATGGGGGAGAAAGGG + Intronic
1089482802 11:118820726-118820748 ATGCAGGAATATTGGGGAAGAGG + Intergenic
1089866792 11:121639708-121639730 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1089953621 11:122551255-122551277 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1089958347 11:122593500-122593522 AAGAAGCAATTGTGGGGTAAAGG + Intergenic
1089987928 11:122831040-122831062 AAGAAGGAAATATGGGGAAATGG - Intergenic
1090526523 11:127544311-127544333 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1090546211 11:127770654-127770676 AAGAAGGGAATGTGGGGAAATGG + Intergenic
1090850337 11:130566150-130566172 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1090856394 11:130612530-130612552 ATGCAAAGATTGTGGGGAAATGG + Intergenic
1090871712 11:130755298-130755320 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1090926680 11:131256279-131256301 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1090930735 11:131295929-131295951 GTGTAGGAATTGTTGGGAAGAGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091158232 11:133393981-133394003 GTGTAGGAAAGGTGGGGGAATGG - Intronic
1091596920 12:1884560-1884582 ATGTAGGAAGTTTGGGGTAAGGG - Intronic
1091833736 12:3569452-3569474 GTTGATGAATTGTGGGGAAATGG - Intronic
1092104251 12:5909865-5909887 ATGTAGGCATTTTGGGGCCATGG + Intronic
1092414755 12:8281835-8281857 AGGAAGGAAATGTGGGGAAATGG + Intergenic
1092474739 12:8808847-8808869 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1092626499 12:10334713-10334735 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1092723481 12:11463967-11463989 AAGAAGGAAATTTGGGGAAATGG + Intronic
1092789964 12:12062311-12062333 AAGAAGGAAATATGGGGAAATGG - Intronic
1092924536 12:13261374-13261396 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1093183860 12:15997829-15997851 ATGTACAAATAATGGGGAAAAGG - Intronic
1093358741 12:18199251-18199273 AAGAAGGAAATGTGGGGAAATGG - Intronic
1093579070 12:20767292-20767314 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1093584274 12:20818797-20818819 ACGAAGGAAATGTGGGGAAATGG + Intronic
1093812547 12:23507608-23507630 AAGAAGGAAATATGGGGAAATGG + Intergenic
1094315763 12:29136560-29136582 AAGAAGGAAATATGGGGAAATGG + Intergenic
1094400961 12:30060115-30060137 AAGAAGGAAATATGGGGAAATGG - Intergenic
1094826048 12:34269925-34269947 CAGAAGGAAATGTGGGGAAATGG - Intergenic
1095778475 12:46034279-46034301 AAGAAGGAAATATGGGGAAATGG - Intergenic
1096814005 12:54190148-54190170 ATGGGGGAATGGTGGGGGAATGG - Intergenic
1097398836 12:59105757-59105779 GGGAAGGAAATGTGGGGAAACGG - Intergenic
1097416802 12:59325009-59325031 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1097501041 12:60402564-60402586 ATGAAGGCATAGTGTGGAAAAGG + Intergenic
1097541906 12:60953559-60953581 AAGAAGGAAATATGGGGAAATGG + Intergenic
1097592618 12:61590790-61590812 AAGAAGGAAATATGGGGAAATGG - Intergenic
1098173386 12:67768424-67768446 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1098402510 12:70089330-70089352 AAGCAGGAAATATGGGGAAATGG - Intergenic
1098611824 12:72468059-72468081 ATGGAAGAATGGAGGGGAAAAGG - Intronic
1098629741 12:72710471-72710493 AAGAAGGAAATATGGGGAAATGG + Intergenic
1099188970 12:79543791-79543813 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1099291845 12:80784867-80784889 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1099635895 12:85211010-85211032 TTGTAGAAATTGAGGGGCAAAGG + Intronic
1099762876 12:86942941-86942963 AAGAAGGAAATCTGGGGAAATGG - Intergenic
1099835814 12:87908977-87908999 AAGAAGGAAATATGGGGAAATGG + Intergenic
1101278143 12:103224468-103224490 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1101392242 12:104312032-104312054 ATATGGGTATTGTGTGGAAATGG + Intronic
1101569231 12:105937741-105937763 ATGTAGTAAATTTGGGGAATTGG - Intergenic
1102116493 12:110407080-110407102 AAGAAGGAAATATGGGGAAATGG + Intergenic
1102904802 12:116666314-116666336 GTGTAGGGATTGGAGGGAAAAGG + Intergenic
1107017203 13:35717052-35717074 ATCCAGGAATTGCTGGGAAAGGG - Intergenic
1107075835 13:36320372-36320394 AAGAAGGAAATTTGGGGAAATGG - Intronic
1107220013 13:37970758-37970780 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1108202979 13:48060512-48060534 AAGAAGGAAATATGGGGAAATGG - Intronic
1108281769 13:48868687-48868709 AAGAAGGAAATATGGGGAAATGG + Intergenic
1108913167 13:55580027-55580049 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1108919299 13:55656746-55656768 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1108952699 13:56114203-56114225 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1109011915 13:56960033-56960055 AAATAGGAATTGTGGGGAAGAGG - Intergenic
1109343880 13:61092664-61092686 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1109499551 13:63217034-63217056 AAGAAGGAAATATGGGGAAATGG - Intergenic
1109716486 13:66228167-66228189 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1110395842 13:75028760-75028782 ATGAAGAACTTGTTGGGAAATGG + Intergenic
1110552596 13:76825748-76825770 ATGTAGGAACTTTTGGGAAAGGG + Intergenic
1110650204 13:77934906-77934928 AAGAAGGAAATATGGGGAAATGG + Intergenic
1110662943 13:78079657-78079679 TTGAAGAAATTGTGGAGAAAAGG - Intergenic
1110677930 13:78272065-78272087 TGATAGGTATTGTGGGGAAAAGG - Intergenic
1110738108 13:78962119-78962141 TTGTAGGGATTGCGGAGAAATGG + Intergenic
1110765737 13:79278057-79278079 AAGAAGGAAATATGGGGAAATGG - Intergenic
1110845593 13:80187607-80187629 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1111125784 13:83910068-83910090 AAGAAGGAAATATGGGGAAATGG + Intergenic
1111302299 13:86362335-86362357 AAGAAGGAAATCTGGGGAAATGG - Intergenic
1111361854 13:87188207-87188229 AAGAAGGAAATATGGGGAAATGG + Intergenic
1111630684 13:90843347-90843369 AAGAAGGAAATATGGGGAAATGG - Intergenic
1111631450 13:90850372-90850394 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1112237115 13:97646435-97646457 AAGAAGAAAATGTGGGGAAATGG - Intergenic
1112524058 13:100126658-100126680 ATGTATGTATTTTGGGGGAATGG + Intronic
1112822810 13:103355961-103355983 ATGGAGGATTTGTGGGTATAGGG + Intergenic
1113207843 13:107938743-107938765 AGCTAGGAATGGAGGGGAAATGG - Intergenic
1114176987 14:20330918-20330940 AAGTAGGAAATGAGGGGAAGGGG - Intronic
1115587536 14:34829589-34829611 TTGTAGGAATGGTAGGGAAGTGG - Intronic
1115790248 14:36869941-36869963 ATGTGGAAATAGTAGGGAAAAGG + Intronic
1115804593 14:37036686-37036708 ATTTTGGAAGTGTGGGGAATGGG - Intronic
1115905061 14:38194721-38194743 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1116043812 14:39718287-39718309 ATGTAAGAACTGTGGAGAAATGG + Intergenic
1116088198 14:40268246-40268268 ATGCAGGCATTATGAGGAAAAGG + Intergenic
1116179959 14:41520086-41520108 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1116534524 14:46014209-46014231 AAGAAGGAAATATGGGGAAATGG + Intergenic
1116573704 14:46547837-46547859 AAGAAGGAAATATGGGGAAATGG - Intergenic
1116702112 14:48256954-48256976 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1117801433 14:59448006-59448028 AAGAAGGAAATATGGGGAAATGG - Intronic
1117957626 14:61134993-61135015 AAGAAGGAAATATGGGGAAATGG + Intergenic
1118009447 14:61594468-61594490 ATGTAGTAGTTGTGGGGAGATGG + Intronic
1118748230 14:68789431-68789453 ATGTAGGGCCTGTGGGGAATGGG + Exonic
1119022668 14:71128228-71128250 AAGAAGGAAATATGGGGAAATGG - Intergenic
1119317453 14:73707416-73707438 AAGAAGGAAATATGGGGAAATGG - Intergenic
1119386563 14:74261029-74261051 ATGGAGGACCTGTGGGGAACAGG - Exonic
1119981674 14:79088464-79088486 ATATAAGAACTCTGGGGAAAGGG - Intronic
1119986941 14:79148822-79148844 AGGGAGGATTTGTGGAGAAAAGG - Intronic
1120049621 14:79850024-79850046 ATGGAGGAATTCTGGGAGAATGG - Intronic
1120437799 14:84502000-84502022 AAGAAGGAAATATGGGGAAATGG + Intergenic
1120539313 14:85734755-85734777 AAGAAGGAAATATGGGGAAATGG + Intergenic
1120860527 14:89251206-89251228 ATGTAGGATATGTGGGAAGAAGG - Intronic
1121108402 14:91295762-91295784 CTGTATGAATTCTGGGGACATGG - Intronic
1121193002 14:92046351-92046373 AAGAAGGAAGTATGGGGAAATGG + Exonic
1121277112 14:92676078-92676100 ATGTATGATTCGTGGGGATAGGG + Intronic
1121389722 14:93563702-93563724 AAGAAGGAAATATGGGGAAATGG + Intronic
1121703937 14:95977090-95977112 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1121980352 14:98449057-98449079 AAGAAGGAAATATGGGGAAATGG + Intergenic
1122507927 14:102243758-102243780 AAGAAGGAAATATGGGGAAATGG - Intronic
1123130364 14:105980906-105980928 ATGTATGAATGGAGGGGAAGTGG - Intergenic
1124696054 15:31865315-31865337 TTAGAGGAATTGTGAGGAAATGG + Intronic
1125038801 15:35159091-35159113 ATGTCGGAATTTGGGGAAAAAGG - Intergenic
1125131261 15:36287423-36287445 AAGAAGGAAATATGGGGAAATGG + Intergenic
1125760348 15:42092201-42092223 ATGTAGAAAATGGGAGGAAATGG - Intronic
1125849336 15:42888404-42888426 AAGAAGGAAATATGGGGAAATGG - Intronic
1126844055 15:52742880-52742902 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1126912159 15:53428627-53428649 AAGAAGGAAATATGGGGAAATGG + Intergenic
1127070994 15:55288916-55288938 ATGTTGGAATTGGGGGTAGAGGG - Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1127303689 15:57681956-57681978 ATGTGGGAAGTTAGGGGAAAGGG + Intronic
1127490744 15:59460238-59460260 ATGGAGCAATTCTGTGGAAAGGG - Intronic
1127628715 15:60805401-60805423 ATGTAGGAAATGCAGGGAGAAGG + Intronic
1130561497 15:84962909-84962931 ATGTGGGAATTGTGAGGGAGGGG - Intergenic
1130696460 15:86136482-86136504 ATGTGGCAATTGTGGGTAATGGG + Intergenic
1130781360 15:87043787-87043809 AAGAAGGAAATATGGGGAAATGG - Intergenic
1130855359 15:87835193-87835215 AAGAAGGAAATATGGGGAAATGG - Intergenic
1130945660 15:88549072-88549094 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1131369794 15:91870149-91870171 AGGTATGAATTCTGGGGAAAGGG + Intronic
1131414887 15:92246129-92246151 AAGTAGAATTTGTGGGGATAAGG + Intergenic
1131442274 15:92467967-92467989 AAGGAGGGATTGTGGGGGAAGGG - Exonic
1131448026 15:92515641-92515663 AAGGAGGAAATATGGGGAAATGG - Intergenic
1131547224 15:93326005-93326027 ATTTGGGAATTGTGGGGTATTGG - Intergenic
1131684435 15:94754696-94754718 AAGAAGGAAATATGGGGAAATGG - Intergenic
1131684999 15:94758607-94758629 AAGAAGGAAATATGGGGAAATGG - Intergenic
1131882260 15:96873603-96873625 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1132263302 15:100444429-100444451 AAGAAGGAAATGTGGGGAAATGG - Intronic
1132340677 15:101076469-101076491 AAGAAGGAAATGTGGGGAAATGG - Intronic
1132928846 16:2448157-2448179 ATCTAGGAATTGGAGGCAAAGGG - Intronic
1133765470 16:8834814-8834836 AAGAAGGAAATATGGGGAAATGG + Intronic
1133766475 16:8841711-8841733 AAGAAGGAAATATGGGGAAATGG + Intronic
1133869294 16:9672871-9672893 AAGAAGGAAATGTGGGGAAATGG + Intronic
1134341929 16:13354359-13354381 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1135941305 16:26824559-26824581 AGGTAGGAACTTTGGCGAAATGG - Intergenic
1136295231 16:29297831-29297853 ATGGATGAATTGTGGATAAATGG + Intergenic
1136295249 16:29297930-29297952 ATGGATGAATTGTGGATAAATGG + Intergenic
1136295281 16:29298105-29298127 ATGGATGAATTTTGGGTAAATGG + Intergenic
1137276399 16:46936978-46937000 GTGTTGGAAATGTTGGGAAATGG - Intergenic
1137363721 16:47842699-47842721 AAGAAGGAAATATGGGGAAATGG - Intergenic
1138758841 16:59519422-59519444 AAGAAGGAAATATGGGGAAATGG + Intergenic
1138805202 16:60082756-60082778 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1139038983 16:62980930-62980952 AAGAAGGAAATATGGGGAAATGG + Intergenic
1139225663 16:65231611-65231633 AAGAAGGAAATCTGGGGAAATGG + Intergenic
1139942801 16:70618264-70618286 AAGAAGGAAATTTGGGGAAATGG + Intronic
1139943463 16:70622583-70622605 AAGAAGGAAATTTGGGGAAATGG + Intronic
1139994464 16:70966952-70966974 AAGTAGGAAATATGGGGGAAGGG + Intronic
1141006989 16:80361798-80361820 ATGTTGGAGATGGGGGGAAAGGG + Intergenic
1141220298 16:82063299-82063321 ATGTAGTAATTGTTTGGAATAGG + Intronic
1141864947 16:86743812-86743834 AGGAAGGAAATTTGGGGAAATGG + Intergenic
1142101131 16:88271842-88271864 ATGGATGAATTGTGGATAAATGG + Intergenic
1142101150 16:88271941-88271963 ATGGATGAATTGTGGATAAATGG + Intergenic
1142101180 16:88272111-88272133 ATGGATGAATTTTGGGTAAATGG + Intergenic
1142276487 16:89121551-89121573 GTTTAGGGATTATGGGGAAATGG + Intronic
1143094206 17:4468402-4468424 ATGGAGGAAGTGTGGAGAAGTGG + Intronic
1143416239 17:6753046-6753068 TTGCAGGAATCGGGGGGAAAGGG - Intergenic
1144539261 17:16123259-16123281 ATGTAGGAAGTATGGGAAGAGGG - Intronic
1144589540 17:16512593-16512615 ATGTAGGAGTGGTGGGGGAGGGG - Intergenic
1146018140 17:29249866-29249888 ATGAAGGAACTGTGGTGGAATGG + Intronic
1146569978 17:33944172-33944194 ATGTAGGCATTGAGTGGAAGTGG - Intronic
1147512293 17:41081474-41081496 CTGCAGGAGTTGTGGGGCAATGG + Intergenic
1147514465 17:41102645-41102667 CTGCAGGAGTTGTGGGGCAATGG + Intronic
1148427157 17:47608682-47608704 ATTTAGAGATTGTGTGGAAAAGG + Intronic
1148507070 17:48135897-48135919 ATGTGGGGATTTTGGGGAAATGG + Intronic
1148717167 17:49723963-49723985 AGAAGGGAATTGTGGGGAAATGG - Intronic
1150159129 17:62879721-62879743 ATGAAGGGTTTGTGGGGCAATGG + Intergenic
1151153879 17:72111007-72111029 ATGTAGGAAGTGTGGGGTGTCGG - Intergenic
1151622743 17:75256495-75256517 AAGAAGGAAATATGGGGAAATGG - Intronic
1151839494 17:76607742-76607764 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1152688248 17:81705450-81705472 TTGTAAGCATTGTGGGGAAAAGG + Intronic
1153802065 18:8680077-8680099 ATGTTGGAAATATGGGGCAATGG - Intergenic
1153881396 18:9424677-9424699 AAGAAGGAAATATGGGGAAATGG + Intergenic
1154482962 18:14855341-14855363 AAGAGGGAAATGTGGGGAAAAGG - Intergenic
1155174114 18:23288188-23288210 AAGAAGGAAATGTGGGGAAATGG - Intronic
1155495064 18:26434768-26434790 ATTTAGAAATTAAGGGGAAATGG - Intergenic
1155623251 18:27805904-27805926 ATTGAGGATTTGTAGGGAAAGGG + Intergenic
1155892515 18:31286520-31286542 AAGAAGGAAATATGGGGAAATGG + Intergenic
1156251645 18:35357900-35357922 AAGAAGGAAATATGGGGAAATGG + Intergenic
1156421450 18:36957922-36957944 AGGTATGAATTTTGGGGGAAAGG - Intronic
1156916084 18:42465544-42465566 AAGAAGGAAATATGGGGAAATGG - Intergenic
1156923862 18:42554695-42554717 AAGAAGGAAATATGGGGAAATGG + Intergenic
1156958481 18:42995036-42995058 AAGAAGGAAATATGGGGAAATGG - Intronic
1157763621 18:50282113-50282135 ACGTGGGGCTTGTGGGGAAAAGG + Intergenic
1157906138 18:51571821-51571843 AAGAAGGAAATATGGGGAAATGG + Intergenic
1158307244 18:56119634-56119656 AGGTAGCAATCTTGGGGAAAAGG - Intergenic
1158336625 18:56419522-56419544 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1158394393 18:57068414-57068436 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1158576544 18:58643496-58643518 AAGAAGGAAATATGGGGAAATGG + Intergenic
1158826289 18:61223997-61224019 AAGAAGGAATTGTGGGGGAAGGG - Intergenic
1159164739 18:64685556-64685578 AAGAAGGAAGTATGGGGAAATGG - Intergenic
1159728835 18:71999150-71999172 ATGAAGGAATTGTGGAAAAAGGG - Intergenic
1159835296 18:73328565-73328587 AAGAAGGAAATATGGGGAAATGG - Intergenic
1159899548 18:74032642-74032664 ATGAAGGAATTCAGGGGTAATGG + Intergenic
1160134557 18:76261426-76261448 AGGCAGGAATTGTGTTGAAAAGG + Intergenic
1162578189 19:11511562-11511584 ATGTAGCAAGTGTTGGGAGAAGG + Intronic
1164019309 19:21283750-21283772 ATGTTGAAGTTGTGGAGAAAAGG - Intronic
1164153230 19:22572167-22572189 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1164202223 19:23028428-23028450 AAGAAGGAAATATGGGGAAATGG + Intergenic
1164220314 19:23187394-23187416 AAGAAGGAAATATGGGGAAATGG - Intergenic
1164575029 19:29400888-29400910 ATGTGGGCATGGTGGGGACAGGG + Intergenic
1165496749 19:36157207-36157229 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1165510072 19:36261276-36261298 AAGAAGGAAATATGGGGAAATGG + Intergenic
1165835618 19:38753536-38753558 AAGAAGGAAATGTGGGGAAATGG - Intronic
1166143979 19:40821871-40821893 ATGTGGGGTTTCTGGGGAAAAGG + Intronic
1166183630 19:41125225-41125247 ATGTGGGGTTTCTGGGGAAAAGG - Intronic
1166905470 19:46105470-46105492 AAGAAGGAAATATGGGGAAATGG + Intergenic
1167046357 19:47051610-47051632 AAGAAGGAAATATGGGGAAATGG + Intergenic
1167099722 19:47396961-47396983 AAGAAGGAAATATGGGGAAATGG - Intergenic
1167180947 19:47903117-47903139 GTGCAGGGATTGAGGGGAAAGGG - Intergenic
1167902401 19:52631699-52631721 AAGAAGGAAATATGGGGAAATGG - Intronic
1168211873 19:54896677-54896699 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1168227731 19:55008582-55008604 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1168248510 19:55126946-55126968 AAGAAGGAAATATGGGGAAATGG - Intergenic
925431053 2:3793577-3793599 TTGTATGAATGGAGGGGAAATGG + Intronic
925544803 2:5004909-5004931 AAGAAGGAAATTTGGGGAAATGG - Intergenic
925828573 2:7874484-7874506 AAGAAGGAAATTTGGGGAAATGG + Intergenic
926408015 2:12573679-12573701 AAGAAGGAAATGTGGGGAAATGG - Intergenic
926463835 2:13165777-13165799 AAGAAGGAAATATGGGGAAATGG + Intergenic
926815293 2:16793724-16793746 AAGAAGGAAATATGGGGAAATGG + Intergenic
927166836 2:20331556-20331578 AGGTAGTCAATGTGGGGAAAGGG + Intronic
927226599 2:20771955-20771977 TTGCAGGAATAGTGGTGAAAAGG - Intronic
927509998 2:23638557-23638579 ATGGAGGAAGTGTGGGGAAGTGG - Intronic
928770563 2:34698890-34698912 AAGAAGGAAATATGGGGAAATGG + Intergenic
928771049 2:34702277-34702299 AAGAAGGAAATATGGGGAAATGG - Intergenic
928857426 2:35817013-35817035 AAGAAGGAAATATGGGGAAATGG - Intergenic
929076416 2:38082550-38082572 AAGAAGGAAATATGGGGAAATGG + Intronic
929383858 2:41382236-41382258 AAGAAGGAAATATGGGGAAATGG - Intergenic
929684238 2:44020618-44020640 AAGAAGGAAATATGGGGAAATGG + Intergenic
929792807 2:45036220-45036242 AAGAAGGAAATATGGGGAAATGG + Intergenic
930098748 2:47587052-47587074 AAGAAGGAAATATGGGGAAATGG + Intergenic
930487068 2:52023678-52023700 AAGAAGGAAATATGGGGAAATGG + Intergenic
930851041 2:55960603-55960625 ATGTGGGGATTGGGGGGACAGGG + Intergenic
930958653 2:57232818-57232840 AAGAAGGAAATATGGGGAAATGG - Intergenic
931026141 2:58115207-58115229 AAGAAGGAAATATGGGGAAATGG + Intronic
931042867 2:58317623-58317645 AAGAAGGAAATATGGGGAAATGG - Intergenic
931133455 2:59367219-59367241 AACAAGTAATTGTGGGGAAAGGG - Intergenic
931237192 2:60421530-60421552 AAGAAGGAAATATGGGGAAATGG - Intergenic
931292649 2:60889183-60889205 AGGTAGGTATTCTAGGGAAAAGG - Intronic
931948540 2:67335741-67335763 AAGAAGGAAATGTGGGGAAATGG - Intergenic
932251396 2:70247734-70247756 ATATATCAATTGAGGGGAAATGG - Intronic
932296113 2:70624642-70624664 AAGAAGGAAATGTGGGGAAATGG - Intronic
932524727 2:72452496-72452518 GGGTATGAATTGTGGGAAAAAGG + Intronic
932853956 2:75215553-75215575 AAGAAGGAAATTTGGGGAAATGG + Intergenic
933013342 2:77092303-77092325 AAGAAGGAAATTTGGGGAAATGG - Intronic
933079517 2:77969032-77969054 AAGAAGGAAATTTGGGGAAATGG - Intergenic
933163974 2:79055301-79055323 AAGAAGGAAATATGGGGAAACGG - Intergenic
935933463 2:108155182-108155204 AGGTAAGAATTGTGGCAAAATGG + Intergenic
935977507 2:108593407-108593429 ATAAAGGAATGCTGGGGAAAAGG + Intronic
936749640 2:115626469-115626491 ATGTATAAATCATGGGGAAATGG - Intronic
936883581 2:117282662-117282684 AGGAAGGAACTTTGGGGAAATGG - Intergenic
936968666 2:118152605-118152627 ATGAAGGAAGTGTGAGCAAAGGG + Intergenic
937518819 2:122686087-122686109 ATGAAGAATTTGTAGGGAAATGG - Intergenic
937594717 2:123659741-123659763 AAGAAGGAAATATGGGGAAATGG + Intergenic
939082893 2:137684725-137684747 AAGAAGGAAATATGGGGAAATGG + Intergenic
939094823 2:137822492-137822514 AAGAAGGAAATATGGGGAAATGG - Intergenic
939176673 2:138757178-138757200 TTGTAGGAAATATGAGGAAATGG - Intronic
939307658 2:140430065-140430087 AAGAAGGAAATATGGGGAAATGG - Intronic
939976366 2:148720937-148720959 ATGAAGCAATTCTGGGGACAGGG - Intronic
940107634 2:150116741-150116763 AAGAAGGAAATATGGGGAAATGG - Intergenic
940184010 2:150962609-150962631 AAGAAGGAAATATGGGGAAATGG - Intergenic
940530446 2:154871242-154871264 AAGAAGGAAATATGGGGAAATGG - Intergenic
940663495 2:156576670-156576692 ATAAAGGAAATGTGGGGTAAGGG + Intronic
940675563 2:156721849-156721871 AAGAAGGAAATATGGGGAAATGG + Intergenic
941340648 2:164299775-164299797 AAGAAGGAAATATGGGGAAATGG - Intergenic
941353636 2:164463043-164463065 AAGAAGGAAATTTGGGGAAATGG - Intergenic
941433258 2:165436724-165436746 ATGTAGTCAGTGTGGGGAAAGGG - Intergenic
941455884 2:165711905-165711927 AAGAAGGAAATGTGGGGAAATGG + Intergenic
941935605 2:170979207-170979229 AAGAAGGAAATGTGGGGAAATGG + Intergenic
942730008 2:179053333-179053355 AAGAAGGAAATGAGGGGAAATGG + Intergenic
943326752 2:186508406-186508428 CTGGAGTAATTCTGGGGAAATGG + Intronic
943412672 2:187562268-187562290 AAGAAGGAAATGTAGGGAAATGG + Intronic
943421325 2:187672273-187672295 AAGAAGGAAATGTGAGGAAATGG + Intergenic
943450424 2:188037356-188037378 AAGAAGGAAATATGGGGAAATGG - Intergenic
943460940 2:188170987-188171009 AAGAAGGAAATATGGGGAAATGG + Intergenic
943806890 2:192134340-192134362 AAGAAGGAAATGTGGGGAAATGG - Intronic
943835651 2:192511398-192511420 AAGAAGGAAATATGGGGAAATGG - Intergenic
943865627 2:192922198-192922220 AAGAAGGAAATATGGGGAAATGG - Intergenic
944050955 2:195468974-195468996 ATGTAAGTATTCTGGAGAAATGG - Intergenic
944121810 2:196248542-196248564 CTGTAGGAAAGGTGGGGAAAGGG + Intronic
944251340 2:197582410-197582432 AAGAAGGAAATATGGGGAAATGG - Intronic
944387700 2:199183300-199183322 AAGAAGGAAATGTGGGGAAATGG - Intergenic
944394392 2:199250858-199250880 AAGAAGGAAATTTGGGGAAATGG - Intergenic
944875864 2:203963702-203963724 AAGGAGGAAATGTGGGGAAATGG + Intergenic
945173763 2:207021546-207021568 AAGAAGGAAATGTGCGGAAATGG - Intergenic
945376357 2:209081999-209082021 AAGAAGGAAATGTGGGGAAATGG - Intergenic
945394547 2:209303127-209303149 AAGAAGGAAATATGGGGAAATGG - Intergenic
945554952 2:211265368-211265390 AAGAAGGAAATGTGGGGAAATGG - Intergenic
945747341 2:213734269-213734291 ATGTTAGAATTGTGGGCAAATGG - Intronic
945938576 2:215926306-215926328 AAGAAGGAAATTTGGGGAAATGG - Intergenic
945940635 2:215946061-215946083 AGGTAGGAATTCTGGGGACAGGG - Intronic
946092707 2:217244604-217244626 ATGGAGGAAGAGTTGGGAAAGGG - Intergenic
946214781 2:218175799-218175821 AAGAAGGAAATATGGGGAAATGG + Intergenic
946592195 2:221262847-221262869 AGGTAGCAATTGTGGGCAGAGGG - Intergenic
946780619 2:223190471-223190493 AATAAGGAAATGTGGGGAAATGG + Intronic
946871479 2:224089422-224089444 AAGAAGGAAATATGGGGAAATGG + Intergenic
946886755 2:224229216-224229238 AAGAAGGAAATATGGGGAAATGG - Intergenic
947842537 2:233217424-233217446 AAGAAGGAAATATGGGGAAATGG + Intronic
948390945 2:237610876-237610898 AAGAAGGAAATATGGGGAAATGG - Intergenic
1170068617 20:12342056-12342078 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1170325205 20:15149398-15149420 AAGAAGGAAATGTGGGGAAATGG + Intronic
1170412669 20:16107811-16107833 ATGTAGGAATTGTAGAGGAAGGG + Intergenic
1170820445 20:19752945-19752967 AAGAAGGAAATATGGGGAAATGG + Intergenic
1171127239 20:22613221-22613243 ATATATGAATTGAGGGTAAAGGG + Intergenic
1172932159 20:38594119-38594141 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1173019542 20:39255557-39255579 ACGTATGAATTTTGGGGGAATGG + Intergenic
1173102161 20:40097256-40097278 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1173119115 20:40272937-40272959 AAGAAGGAAATATGGGGAAATGG - Intergenic
1173763493 20:45585778-45585800 AAGAAGGAAATATGGGGAAATGG + Intergenic
1173781972 20:45763587-45763609 AAGAAGGAAATATGGGGAAATGG - Intronic
1175664674 20:60848307-60848329 AGGTAGTATTTCTGGGGAAATGG - Intergenic
1177100931 21:16896468-16896490 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1177102961 21:16918127-16918149 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1177119825 21:17125417-17125439 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1177376494 21:20276841-20276863 ATGTAGGCCTTCTGGGTAAATGG - Intergenic
1177760065 21:25393086-25393108 AGGAAGAAATTGAGGGGAAAAGG + Intergenic
1177840463 21:26229595-26229617 AAGAAGGAAATATGGGGAAATGG + Intergenic
1177881977 21:26704837-26704859 ATGTTGGAATTGAATGGAAAAGG - Intergenic
1178001447 21:28165131-28165153 AAGAAGGAAATATGGGGAAATGG - Intergenic
1178106641 21:29326746-29326768 ATGGAAGAATTGTGGGGGAAAGG - Exonic
1178251098 21:31004059-31004081 ATGTGGGCATTGAGAGGAAAAGG + Intergenic
1178489808 21:33042274-33042296 CTATAGGAGCTGTGGGGAAACGG + Intergenic
1179014968 21:37588510-37588532 AAGAAGGAAATATGGGGAAATGG + Intergenic
1179387811 21:40958877-40958899 AAGAAGGAAATATGGGGAAACGG - Intergenic
1179638373 21:42730082-42730104 ACTTAGGAATTGTCTGGAAAAGG - Intronic
1179650078 21:42802613-42802635 AAGAAGGAAATATGGGGAAACGG + Intergenic
1179662933 21:42889697-42889719 ATGTAGTAATTCTGGGTAAAAGG - Intronic
1180822302 22:18838864-18838886 CTGTTGGAATTGTGGGGTAGGGG - Intergenic
1181042822 22:20200636-20200658 ATGTAGGCAGAGTGGGGACAAGG + Intergenic
1181118719 22:20650840-20650862 GTGTGGGAATTGTGGGGAGAAGG - Intergenic
1181190671 22:21137182-21137204 CTGTTGGAATTGTGGGGTAGGGG + Intergenic
1182040845 22:27237863-27237885 ATGTAGAATTTGAGGGGAGAGGG + Intergenic
1182250562 22:28996900-28996922 ATGTAGATATTGTGGGGATGAGG + Intronic
1182732534 22:32506698-32506720 AAGAAGGAAATATGGGGAAATGG - Intergenic
1182998853 22:34838243-34838265 AAGAAGGAAATATGGGGAAATGG - Intergenic
1183385576 22:37512317-37512339 ATGAAGTCATTGTTGGGAAAAGG + Intronic
1183491145 22:38116264-38116286 GGGTGTGAATTGTGGGGAAAGGG - Intronic
1183635349 22:39058865-39058887 AAGAAGGAAATATGGGGAAATGG + Intronic
1184382566 22:44155109-44155131 ATGTAAGAATGGTTTGGAAAAGG - Intronic
1184841465 22:47054778-47054800 ACGTAGAAGTTGTGGGGCAAGGG + Intronic
1203218398 22_KI270731v1_random:22087-22109 CTGTTGGAATTGTGGGGTAGGGG + Intergenic
1203272435 22_KI270734v1_random:64749-64771 CTGTTGGAATTGTGGGGTAGGGG - Intergenic
949827694 3:8180936-8180958 AAGAAGGAAATATGGGGAAATGG - Intergenic
950926744 3:16748242-16748264 AAGAAGGAAATATGGGGAAATGG - Intergenic
951298560 3:20969295-20969317 AAGAAGGAAATTTGGGGAAATGG + Intergenic
951332081 3:21380349-21380371 AAGAAGGAAATATGGGGAAATGG + Intergenic
951894871 3:27601060-27601082 AAGAAGGAAATATGGGGAAATGG - Intergenic
952343326 3:32463243-32463265 AAGAAAGAAATGTGGGGAAATGG + Intronic
952663214 3:35876112-35876134 AAGAAGGAAATATGGGGAAATGG + Intergenic
952894913 3:38072072-38072094 AAGAAGGAAATGTGGGGAAATGG + Intronic
952895802 3:38078060-38078082 AAGAAGGAAATATGGGGAAATGG + Intronic
955068560 3:55553439-55553461 ATGGAGGTATTGTGGGGTTAAGG + Intronic
955209879 3:56930753-56930775 ATGTAGTAAGTGAAGGGAAATGG + Intronic
955500855 3:59581179-59581201 CTGTAGAAATTCTGGGGAACAGG - Intergenic
955520707 3:59772874-59772896 ATGTAGGAAGTGTAGGGCCAGGG + Intronic
955979844 3:64513869-64513891 CTGTAGGAGTAGTGGGGAAATGG - Intergenic
956216696 3:66856976-66856998 ATGTAGGATCTTGGGGGAAAAGG + Intergenic
956327606 3:68070849-68070871 ATGAAGAACTTGTGGGGAACTGG - Intronic
956548710 3:70436433-70436455 AAGAAGGAAATATGGGGAAATGG + Intergenic
956561559 3:70582280-70582302 AAGTAGGAATTGGGGAAAAAAGG + Intergenic
956709507 3:72027127-72027149 AAGAAGGAAATGTGGGGAAATGG - Intergenic
957059637 3:75471646-75471668 AAGAAGGAAATGTGGGGAAATGG + Intergenic
957734639 3:84189739-84189761 AAGAAGGAAATATGGGGAAATGG + Intergenic
957986005 3:87573622-87573644 AAGAAGGAAATATGGGGAAATGG - Intergenic
958073497 3:88645447-88645469 ATGGATGAATTGTGTGGAGAGGG - Intergenic
958152223 3:89705080-89705102 ATGAAGGACTTGTTGGGAACTGG - Intergenic
958422245 3:93942053-93942075 AAGAAGGAAATATGGGGAAATGG - Intronic
958751286 3:98195227-98195249 AAGAAGGAAATATGGGGAAATGG - Intronic
959288103 3:104441703-104441725 AAGAAGGAAATATGGGGAAATGG + Intergenic
959972012 3:112419343-112419365 AAGAAGGAAATATGGGGAAATGG + Intergenic
960282619 3:115795283-115795305 AAGAAGGAAATTTGGGGAAATGG + Intergenic
960309871 3:116107103-116107125 AAGAAGGAAATATGGGGAAATGG + Intronic
960635223 3:119778488-119778510 ATAAAGGGATTGAGGGGAAAAGG - Intergenic
961164508 3:124754343-124754365 AAGAAGGAAATATGGGGAAATGG + Intergenic
961293764 3:125867733-125867755 AAGAAGGAAATGTGGGGAAATGG - Intergenic
961572397 3:127809140-127809162 ATGTAGGGAGTGAGGGGAATTGG + Intronic
961711373 3:128830983-128831005 AAGAAGGAAATATGGGGAAATGG + Intergenic
961730837 3:128963614-128963636 AAGAAGGAAATATGGGGAAATGG - Intronic
961881301 3:130063193-130063215 AAGAAGGAAATGTGGGGAAATGG - Intergenic
961892305 3:130140452-130140474 AAGAAGGAAATGTGGGGAAATGG + Intergenic
962336250 3:134533968-134533990 ATATAGGGTTTGGGGGGAAAAGG - Intronic
962564119 3:136639998-136640020 TTGTAGTAATTATGTGGAAAGGG - Intronic
962660922 3:137599616-137599638 AAGAAGGAAATGTGGGGAAATGG - Intergenic
963058908 3:141209088-141209110 AAGAAGGAAATATGGGGAAATGG - Intergenic
963520725 3:146357694-146357716 AAGAAGGAAATATGGGGAAATGG - Intergenic
963521906 3:146366194-146366216 AAGAAGGAAATATGGGGAAATGG - Intergenic
963663603 3:148155576-148155598 AAGAAGGAAATGTGGGGAAATGG - Intergenic
964299976 3:155276753-155276775 AAGAAGGAAATATGGGGAAATGG + Intergenic
964906277 3:161723669-161723691 AAGAAGGAAATATGGGGAAATGG + Intergenic
965262369 3:166502352-166502374 AAGAAGGAAATGTGGGGAAATGG + Intergenic
965335405 3:167426898-167426920 AAGAAGGAAATATGGGGAAATGG - Intergenic
965336614 3:167435357-167435379 AAGAAGGAAATGTGGGGAAATGG - Intergenic
965626067 3:170685116-170685138 AAGAAGGAAATATGGGGAAATGG + Intronic
965639727 3:170819367-170819389 AAGAAGGAAATGTGGGGAAATGG + Intronic
965713666 3:171580341-171580363 AAGAAGGAAATATGGGGAAATGG - Intergenic
965806407 3:172546756-172546778 ATGTAGGAACTGAGGGGTCAGGG + Intergenic
966232599 3:177667636-177667658 AAGAAGGAAATATGGGGAAATGG + Intergenic
966368135 3:179213096-179213118 ACTGAGGATTTGTGGGGAAAAGG + Intronic
966397906 3:179520786-179520808 AAGAAGGAAATTTGGGGAAATGG - Intergenic
966398174 3:179522720-179522742 AAGAAGGAAATATGGGGAAATGG + Intergenic
966777338 3:183554585-183554607 GTGTAGGCAGTGTGGGGAAAGGG - Intronic
967005062 3:185376105-185376127 ATGAAGGAAACATGGGGAAATGG + Intronic
967211910 3:187177311-187177333 AAGAAGGAAATTTGGGGAAATGG + Intronic
967243923 3:187468056-187468078 AAGAAGGAAATATGGGGAAATGG + Intergenic
967496473 3:190148427-190148449 AAGAAGGAAATTTGGGGAAATGG - Intergenic
967561633 3:190924037-190924059 AAGAAGGAAATTTGGGGAAATGG - Intergenic
967601401 3:191393612-191393634 ATGTAGTCATTTTGGAGAAATGG + Intronic
967624369 3:191668059-191668081 AAGAAGGAAATTTGGGGAAATGG + Intergenic
967643573 3:191897126-191897148 AAGAAGGAAATATGGGGAAATGG + Intergenic
967657859 3:192072871-192072893 AAGAAGGAAATATGGGGAAATGG + Intergenic
967740722 3:192999612-192999634 AAGAAGGAAATATGGGGAAATGG - Intergenic
968412962 4:405148-405170 AAGAAGGAAATATGGGGAAATGG + Intergenic
969003538 4:4001832-4001854 AAGAAGGAAATGTGGGGAAATGG + Intergenic
969632088 4:8344705-8344727 ATGGAGGAAGTGAGAGGAAAAGG + Intergenic
969653773 4:8484190-8484212 AAGAAGGAAATGTGGGGAAATGG + Intronic
969750471 4:9106694-9106716 AAGAAGGAAATGTGGGGAAATGG - Intergenic
969810386 4:9642991-9643013 TAGAAGGAAATGTGGGGAAATGG - Intergenic
970256168 4:14172306-14172328 AAGAAGGAAATGTGGGGAAATGG + Intergenic
970402205 4:15728212-15728234 GTTTAGGAATAGTGGGGTAAAGG + Intronic
970532982 4:17001593-17001615 AAGAAGGAAATGTGGGGAAATGG - Intergenic
970741692 4:19247436-19247458 AAATATAAATTGTGGGGAAAGGG - Intergenic
970853802 4:20632080-20632102 AAGAAGGAAATATGGGGAAATGG + Intergenic
971110302 4:23577721-23577743 ATGTATAAATAGAGGGGAAAAGG - Intergenic
971122935 4:23723804-23723826 AAGAAGGAAATATGGGGAAATGG + Intergenic
971200384 4:24504932-24504954 AAGAAGGAAATTTGGGGAAATGG - Intergenic
971411337 4:26375779-26375801 ATGTAGCAAGTCAGGGGAAAGGG + Intronic
971553162 4:27979285-27979307 AAGAAGGAAATATGGGGAAATGG - Intergenic
971978013 4:33715759-33715781 TTGGAGAAAATGTGGGGAAAGGG - Intergenic
972073044 4:35046575-35046597 ATGTTGGATGTGTTGGGAAATGG + Intergenic
972340685 4:38149879-38149901 AAGTAAGATTTGTGAGGAAAGGG + Intergenic
972375779 4:38468886-38468908 AAGTAGGAAATCAGGGGAAATGG - Intergenic
973751364 4:54023569-54023591 AAGAAGGAAATATGGGGAAATGG - Intronic
974074002 4:57152047-57152069 CTGTAGGAACTCAGGGGAAAGGG - Intergenic
974437770 4:61878306-61878328 ATGTATGAATTTTGGGGAAAGGG + Intronic
975099530 4:70496808-70496830 ATGAAGGAGTTATGGGAAAAGGG - Intergenic
975152367 4:71035297-71035319 AAGAAGGAAATATGGGGAAATGG - Intergenic
975696111 4:77014816-77014838 ATGTTGGAATTGTGTAAAAATGG + Intronic
975864838 4:78715643-78715665 AAGAAGGAAATATGGGGAAATGG + Intergenic
975933631 4:79555760-79555782 AAGAAGGAAATTTGGGGAAATGG + Intergenic
976558857 4:86478720-86478742 AAGAAGGAAGTATGGGGAAATGG - Intronic
976615264 4:87069611-87069633 AGGGAGGAAGTGGGGGGAAAGGG - Intronic
976696791 4:87925794-87925816 AAGAAGGAAATTTGGGGAAATGG - Intergenic
976739652 4:88345167-88345189 AAGAAGGAAATATGGGGAAATGG + Intergenic
977010557 4:91628003-91628025 AAGAAGGAAATTTGGGGAAATGG - Intergenic
977012681 4:91656403-91656425 AAGAAGGAAATTTGGGGAAATGG + Intergenic
977062252 4:92273286-92273308 AAGAAGGAAATATGGGGAAATGG + Intergenic
977074955 4:92440752-92440774 AAGAAGGAAATTTGGGGAAATGG + Intronic
977216908 4:94295034-94295056 AAGAAGGAAATATGGGGAAATGG + Intergenic
977225089 4:94385253-94385275 AAGAAGGAAATATGGGGAAATGG + Intergenic
977271880 4:94927022-94927044 ACTTAAGAATTGTGGGTAAATGG - Intronic
977350066 4:95872892-95872914 ATGTTGTAATTGTGGGAAACAGG + Intergenic
978000873 4:103555550-103555572 AAGAAGGAAATATGGGGAAATGG + Intergenic
978031769 4:103945274-103945296 AAGAAGGAAATATGGGGAAATGG - Intergenic
978613948 4:110574820-110574842 ATGTTGGCATTGAGAGGAAAAGG + Intergenic
978996045 4:115154398-115154420 GTGTAAGAAGTGTGGAGAAAAGG - Intergenic
979146859 4:117256015-117256037 AAGAAGGAAATATGGGGAAATGG - Intergenic
979171119 4:117601887-117601909 AAGGAGGAAATATGGGGAAATGG + Intergenic
979850055 4:125563416-125563438 AAGAAGGAAATGTGGGGAAATGG + Intergenic
979894918 4:126146932-126146954 AAGAAGGAAATGTGGGGAAATGG + Intergenic
980349360 4:131666811-131666833 AAGAAGGAAATATGGGGAAATGG - Intergenic
980389170 4:132122118-132122140 AAGAAGGAAATATGGGGAAATGG - Intergenic
980472150 4:133265274-133265296 AAGAAGGAAATATGGGGAAATGG + Intergenic
980485680 4:133455028-133455050 ATGAAGGAAATGTGGAGAAATGG + Intergenic
980528106 4:134016050-134016072 AAGATGGAAATGTGGGGAAATGG - Intergenic
980611528 4:135169087-135169109 AAGAAGGAAATGTGGGGAAATGG + Intergenic
980720211 4:136685983-136686005 CTGCAGGAATTATGGGGAATGGG + Intergenic
980904192 4:138931790-138931812 AAGAAGGAAATGCGGGGAAATGG - Intergenic
981040497 4:140217420-140217442 AAGAAGGAAATATGGGGAAATGG - Intergenic
981070928 4:140537474-140537496 ATGTAGAAAGTGTGAGGAAAAGG + Exonic
981539971 4:145836674-145836696 AAGAAGGAAATTTGGGGAAATGG - Intronic
981820899 4:148886482-148886504 CTGTAGGAATTGAGAGGCAAAGG + Intergenic
982083705 4:151814233-151814255 AAGAAGGAAATATGGGGAAATGG + Intergenic
982180226 4:152743119-152743141 AAGAAGGAAATTTGGGGAAATGG + Intronic
982396478 4:154920637-154920659 AAGAAGGAAATGTGGGGAAATGG + Intergenic
982413916 4:155110071-155110093 AAGAAGGAAATGTGGAGAAATGG + Intergenic
982496869 4:156105267-156105289 AAGAAGGAAATGTGGGGAAATGG + Intergenic
983024130 4:162713024-162713046 AAGAAGGAAATATGGGGAAATGG - Intergenic
983055735 4:163096992-163097014 AAGAAGGAAATATGGGGAAATGG - Intergenic
983345844 4:166524661-166524683 AAGAAGGAAATATGGGGAAATGG - Intergenic
983360664 4:166720232-166720254 AAGAAGGAAATATGGGGAAATGG - Intergenic
983414483 4:167437713-167437735 AAGAAGGAAATATGGGGAAATGG + Intergenic
983433377 4:167679883-167679905 ATGAAGAAATTGAGAGGAAAGGG - Intergenic
983448307 4:167880249-167880271 AAGAAGGAAATGTGGGGAAGTGG - Intergenic
983452588 4:167926818-167926840 AAGAAGGAAATATGGGGAAATGG - Intergenic
983470813 4:168152181-168152203 ATACAGGAAGTGTGGGGAGATGG + Intronic
983805546 4:171987816-171987838 AAGAAGGAAATATGGGGAAATGG + Intronic
984098758 4:175462970-175462992 AAGAAGGAAATATGGGGAAATGG + Intergenic
984163851 4:176285297-176285319 TTGCAGGGAGTGTGGGGAAAGGG - Intergenic
984165098 4:176296633-176296655 AAGAAGGAAATATGGGGAAATGG + Intergenic
984322434 4:178211016-178211038 AAGAAGGAAATGTGGGGAAACGG - Intergenic
984714352 4:182912923-182912945 ATGGAGGAATTCTGGGGGGATGG - Intronic
984798350 4:183688148-183688170 ATTTAGGCATTTTGGGGACAAGG + Intronic
985057111 4:186045773-186045795 AAGAAGGAAATATGGGGAAATGG + Intergenic
985078747 4:186243937-186243959 AAGAAGGAAATATGGGGAAATGG + Intronic
985234077 4:187853333-187853355 TTGGTGGAATTGTGGGGAACTGG + Intergenic
985389604 4:189481154-189481176 AAGAAGGAAATTTGGGGAAATGG + Intergenic
985435989 4:189929992-189930014 AAGAAGGAAATGTGGGGAAATGG - Intergenic
985582597 5:706709-706731 AAGAAGGAAATATGGGGAAATGG - Intergenic
986193775 5:5519466-5519488 AAGAAGGAAATATGGGGAAATGG - Intergenic
986389124 5:7267511-7267533 AGGAAGGAAATTTGGGGAAATGG - Intergenic
986554764 5:9000117-9000139 AAGGAGGAAATGTAGGGAAATGG + Intergenic
986946958 5:13033092-13033114 CCATAAGAATTGTGGGGAAATGG + Intergenic
987282246 5:16423645-16423667 AAGAAGGAAATATGGGGAAATGG - Intergenic
987487085 5:18537599-18537621 AAGAAGGAAATATGGGGAAATGG - Intergenic
987487742 5:18542237-18542259 AAGAAGGAAATATGGGGAAATGG - Intergenic
987808352 5:22800455-22800477 GTGTAGGACTAGTGGGTAAACGG - Intronic
987901542 5:24018404-24018426 ATTTAGGAAATGTGTGGGAATGG - Intronic
988043268 5:25914729-25914751 GTGAAGGAATTGTGGGGTTAAGG - Intergenic
988199381 5:28049781-28049803 AAGAAGGAAATATGGGGAAATGG - Intergenic
989128827 5:38083800-38083822 GTGTAGGCATTTTGAGGAAATGG + Intergenic
989372400 5:40722996-40723018 AAGGGGGAAATGTGGGGAAAAGG + Intronic
989991633 5:50774273-50774295 AAGGAGGAAATGTGGGGAAAAGG - Intronic
990368510 5:55093849-55093871 TTGGAGGAATTGGGGAGAAAAGG + Intergenic
991121722 5:63023613-63023635 ATGTAGGTATTGGGTGGGAAAGG - Intergenic
992261398 5:74974053-74974075 ATGGAGGATTTAGGGGGAAAGGG - Intergenic
992344753 5:75865446-75865468 ATGTGGGAATAGGGTGGAAAAGG + Intergenic
992394916 5:76361263-76361285 AAGAAGGAAATATGGGGAAATGG - Intergenic
992961123 5:81957455-81957477 AAGAAGGAAATATGGGGAAATGG - Intergenic
993189956 5:84669227-84669249 ATGTAGTTAATGTGGGGGAAGGG + Intergenic
993192960 5:84702406-84702428 AAGAAGGAAATTTGGGGAAATGG - Intergenic
993836940 5:92827885-92827907 AAGAAGGAAATATGGGGAAATGG - Intergenic
994125847 5:96168670-96168692 AAGAAGGAAATATGGGGAAATGG + Intergenic
994295390 5:98082995-98083017 AAGAAGGAAATATGGGGAAATGG - Intergenic
994532301 5:100986042-100986064 AAGAAGGAAATGTGGGGAAATGG + Intergenic
994778705 5:104065982-104066004 AAGAAGGAAATGTGGGGAAATGG + Intergenic
994797614 5:104324661-104324683 ATTTAGGAACAGTGGAGAAATGG + Intergenic
994989794 5:106982293-106982315 AAGAAGGAAATCTGGGGAAATGG - Intergenic
995122760 5:108553204-108553226 AAGAAGGAAATTTGGGGAAATGG - Intergenic
995124915 5:108570262-108570284 AAGAAGGAAATATGGGGAAATGG + Intergenic
995127263 5:108590657-108590679 ATGTGGGATGTGAGGGGAAAGGG + Intergenic
995296921 5:110533760-110533782 AAGAAGGAAATGTGGGGAAATGG - Intronic
995769624 5:115654301-115654323 AAGAAGGAAATATGGGGAAATGG - Intergenic
995899121 5:117048160-117048182 AAGAAGGAAATGTGGGGAAATGG + Intergenic
996203010 5:120699373-120699395 AAGAAGGAAATTTGGGGAAATGG + Intergenic
996331446 5:122333919-122333941 AGCCAGAAATTGTGGGGAAATGG + Intronic
996358375 5:122620668-122620690 AAGAAGGAAATATGGGGAAATGG + Intergenic
996510151 5:124307716-124307738 AAGAAGGAAATATGGGGAAATGG - Intergenic
996528295 5:124500974-124500996 AAGAAGGAAATATGGGGAAATGG - Intergenic
996723122 5:126649011-126649033 AAGAAGGAAATATGGGGAAATGG - Intergenic
996725629 5:126671527-126671549 AAGAAGGAAATATGGGGAAATGG + Intergenic
996917915 5:128733257-128733279 AAGAAGGAAATATGGGGAAATGG - Intronic
997172451 5:131737139-131737161 AAGCAGGAATTGTAGGAAAAAGG - Intronic
997678551 5:135733307-135733329 AAGAAGGAAATGTGGGGAAATGG + Intergenic
997746649 5:136305236-136305258 AAGAAGGAAATATGGGGAAATGG - Intronic
997770378 5:136548114-136548136 AAGAAGGAAATTTGGGGAAATGG + Intergenic
997772402 5:136567131-136567153 AAGAAGGAAATTTGGGGAAATGG + Intergenic
997865107 5:137455091-137455113 AGCTAGGAACTGTGGAGAAATGG + Intronic
998482038 5:142470600-142470622 CTGTGGGAATTGACGGGAAAGGG + Intergenic
998679155 5:144446235-144446257 ATGTAGGATTTTGGGGGAAATGG - Intronic
998718420 5:144912638-144912660 ATATTGAAATTGTGGAGAAAAGG + Intergenic
998950208 5:147386152-147386174 ATGTGGGAACTGTAGGGAAAAGG - Exonic
998996151 5:147870768-147870790 AAGAAGGAAATTTGGGGAAATGG + Intronic
1000519150 5:162277188-162277210 AAGAAGGAAATATGGGGAAATGG + Intergenic
1000694066 5:164358461-164358483 ATGCAGGAGCTGTGGGGATATGG + Intergenic
1000841045 5:166219038-166219060 ATGGAGGAAGAGAGGGGAAAAGG + Intergenic
1000935390 5:167299710-167299732 AAGAAGGAAATATGGGGAAATGG + Intronic
1000941916 5:167372013-167372035 AACTAGGAATTGTGGGGAAATGG + Intronic
1001021829 5:168189610-168189632 TTCTAGGAAATGTGGAGAAATGG - Intronic
1001331200 5:170763830-170763852 AAGAAGGAAATGTGGGGAAATGG + Intronic
1001353993 5:171002800-171002822 AAGAAGGAAATATGGGGAAATGG + Intronic
1001499873 5:172222604-172222626 ATGGAGGAATTCTGTAGAAATGG + Intronic
1001914963 5:175552238-175552260 AAGAAGGAGTTATGGGGAAATGG + Intergenic
1002590358 5:180287117-180287139 AGTTATGAATGGTGGGGAAAAGG + Intronic
1003100052 6:3170163-3170185 AAGAAGGAAATATGGGGAAATGG - Intergenic
1003429926 6:6029580-6029602 AAGAAGGAAATATGGGGAAATGG + Intergenic
1004106510 6:12671284-12671306 AAGAAGGAAATATGGGGAAATGG - Intergenic
1004283270 6:14298741-14298763 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1004507745 6:16260777-16260799 AAGAAGGAAATATGGGGAAATGG + Intronic
1004558652 6:16725974-16725996 ATGTGGGTATTGTGGGGAGGAGG - Intronic
1004768321 6:18755855-18755877 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1004837288 6:19543042-19543064 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1004931777 6:20469253-20469275 ATGTAACTATTGGGGGGAAATGG + Intronic
1005014402 6:21363291-21363313 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1005164688 6:22906342-22906364 CTGCAGGAATTCTGGGGAAGAGG + Intergenic
1005548570 6:26893845-26893867 ATGAGGAATTTGTGGGGAAACGG + Intergenic
1005811826 6:29521668-29521690 ATGGAGGAATTCAGGGGAATGGG + Intergenic
1005819905 6:29589188-29589210 GTGAAGGAATAGTGGGGATATGG - Intronic
1006098463 6:31670930-31670952 ATTTTGGAATTCTGGGGAGATGG - Exonic
1007084448 6:39133529-39133551 AAGAAGGAAATATGGGGAAATGG + Intergenic
1007206728 6:40158622-40158644 GGGTAGGAATGGTAGGGAAAGGG - Intergenic
1007389360 6:41541395-41541417 ATGGAGGAACAGTGGGGAGATGG + Intergenic
1007945254 6:45820702-45820724 ATCTAGGTATTGAGGGGACAGGG + Intergenic
1008248531 6:49208295-49208317 ATGCAGAAATTGTTGGGAACTGG - Intergenic
1008256928 6:49313626-49313648 AAATAGAAAATGTGGGGAAAGGG + Intergenic
1009270052 6:61603876-61603898 AAGAAGGAAATATGGGGAAATGG - Intergenic
1009464629 6:63954181-63954203 AAGAAGGAAATATGGGGAAATGG - Intronic
1010586443 6:77662336-77662358 AAGAAGGAAATATGGGGAAATGG + Intergenic
1010810500 6:80293903-80293925 ATGAAGAACTTGTTGGGAAATGG - Intronic
1010894294 6:81346934-81346956 AAGAAGGAAATATGGGGAAATGG + Intergenic
1011367617 6:86599947-86599969 AAGAAGGAAATATGGGGAAATGG + Intergenic
1011770696 6:90672000-90672022 AAGAAGGAAATATGGGGAAATGG + Intergenic
1012054854 6:94393435-94393457 AAGCAGGGAATGTGGGGAAATGG - Intergenic
1012316062 6:97783508-97783530 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1012429035 6:99144862-99144884 ATGTTGGCATGGTGGGGAGATGG + Intergenic
1012675343 6:102105881-102105903 AAGAAGGAAATGTGGGGAAAGGG - Intergenic
1013407638 6:109857535-109857557 AAGAAGGAAATATGGGGAAATGG + Intergenic
1013807799 6:114013900-114013922 AAGAAGGAAATATGGGGAAATGG + Intergenic
1013819576 6:114138441-114138463 ATGGTGGAAATGTGGGCAAAAGG + Intronic
1013843454 6:114424259-114424281 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1013891958 6:115035806-115035828 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1014115041 6:117661124-117661146 AAGAAGGAAATATGGGGAAACGG + Intergenic
1014258719 6:119190885-119190907 ATGAAGTAATTGTGGGGCAGTGG - Intronic
1014359913 6:120464063-120464085 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1014396321 6:120929097-120929119 AAGAAGGAAATATGGGGAAATGG - Intergenic
1014454620 6:121622220-121622242 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1014556095 6:122843750-122843772 AAGAAGGAAATATGGGGAAATGG - Intergenic
1014595937 6:123338769-123338791 ATGTAGAAATAGTTGTGAAAAGG + Intronic
1014614418 6:123584079-123584101 AAGAAGGAAATATGGGGAAATGG + Intronic
1014719146 6:124895962-124895984 AAGAAGGAAATATGGGGAAATGG - Intergenic
1014793739 6:125703650-125703672 AAGAAGGAAATATGGGGAAATGG + Intergenic
1014891791 6:126852666-126852688 AAGAAGGAAATATGGGGAAATGG - Intergenic
1014957382 6:127637655-127637677 GTGTGGGAATGGTGGGGACAGGG + Intergenic
1015053076 6:128865419-128865441 ATGTATCAATTGAGGGAAAAAGG - Intergenic
1015165487 6:130196453-130196475 AAGAAGGAAATGTGGGGAAATGG - Intronic
1015271624 6:131342795-131342817 AAGAAGGAAATATGGGGAAATGG - Intergenic
1015287800 6:131506125-131506147 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1015742518 6:136472213-136472235 TTGTAGGAATTGACAGGAAAAGG - Intronic
1016110655 6:140219241-140219263 AACTAGGTATTGAGGGGAAATGG - Intergenic
1016113894 6:140259236-140259258 AAGAAGGAAATATGGGGAAATGG + Intergenic
1016204809 6:141456952-141456974 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1016249148 6:142019946-142019968 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1016398752 6:143655307-143655329 TTGGGGGAATTGTGGGGAACAGG + Intronic
1016519054 6:144927096-144927118 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1016532460 6:145074042-145074064 ATGTAGTTAATGTGGGAAAAGGG - Intergenic
1016535508 6:145104939-145104961 AAGAAGGAAATATGGGGAAATGG + Intergenic
1016650041 6:146452208-146452230 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1016860613 6:148715176-148715198 CTGTAGAGAATGTGGGGAAATGG - Intergenic
1017094262 6:150790529-150790551 ATGTAGGACTGGTGGGTGAAAGG - Intronic
1017270097 6:152494402-152494424 AAGAAGGAAATATGGGGAAATGG - Intronic
1017304711 6:152903651-152903673 ATGTAACAATACTGGGGAAATGG - Intergenic
1017389756 6:153925411-153925433 AAGAAGGAAATATGGGGAAACGG - Intergenic
1017779094 6:157702440-157702462 AAGAAGGAAATATGGGGAAACGG + Intronic
1017922568 6:158884974-158884996 AAGAAGGAAATATGGGGAAATGG + Intronic
1018077847 6:160232245-160232267 AAGAAGGAAATATGGGGAAATGG - Intronic
1018136008 6:160779015-160779037 AAGAAGGAAATATGGGGAAATGG - Intergenic
1018241931 6:161785577-161785599 ATGAAGGAATTGTGTTGAACTGG - Intronic
1018495147 6:164340524-164340546 AAGAAGGAAATATGGGGAAATGG + Intergenic
1018516195 6:164582239-164582261 ATGCAGAACTTGTTGGGAAATGG - Intergenic
1018521217 6:164653942-164653964 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1018740684 6:166726313-166726335 AAGTAGCAATCCTGGGGAAAGGG + Intronic
1020316302 7:6907705-6907727 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1020322512 7:6949944-6949966 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1020419326 7:7983237-7983259 ATGTAGGAATTTTAGGAAATAGG + Intronic
1020532463 7:9355205-9355227 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1020540852 7:9460121-9460143 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1020607976 7:10361459-10361481 CTGTAGGGGTTGTGGGGTAAGGG + Intergenic
1021172965 7:17418013-17418035 AAGAAGGAAATATGGGGAAATGG - Intergenic
1021393908 7:20124729-20124751 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1021637636 7:22707545-22707567 AAGAAGGAAATATGGGGAAATGG - Intergenic
1021660840 7:22916651-22916673 AAGAAGGAAATATGGGGAAATGG - Intergenic
1021810900 7:24400198-24400220 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1022373126 7:29788762-29788784 AAGAAGGAAATATGGGGAAATGG - Intergenic
1022572510 7:31468606-31468628 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1022709356 7:32836500-32836522 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1022709785 7:32839702-32839724 AAGAAGGAAATATGGGGAAATGG + Intergenic
1022854497 7:34301908-34301930 AAGAAGGAAATATGGGGAAATGG + Intergenic
1023698639 7:42872397-42872419 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1026736714 7:72953649-72953671 GTGTATGAGTTGTTGGGAAAGGG - Intergenic
1027107020 7:75411414-75411436 GTGTATGAGTTGTTGGGAAAGGG + Intergenic
1027852202 7:83463590-83463612 AAGAAGGAAATTTGGGGAAATGG - Intronic
1028228192 7:88274420-88274442 ATGAAGGGATTGAGGGCAAAGGG - Intergenic
1028589591 7:92481190-92481212 AAGAAGGAAATATGGGGAAATGG + Intergenic
1028670754 7:93397857-93397879 AAGAAGGAAATATGGGGAAATGG - Intergenic
1028690420 7:93643779-93643801 AAGAAGGAAATATGGGGAAATGG - Intronic
1028757807 7:94457957-94457979 GTGAAGGGATTGTGGGGCAATGG + Intergenic
1030128692 7:106178811-106178833 ATGTAGGATTTAGGGAGAAAGGG - Intergenic
1030441404 7:109593612-109593634 AAGAAGGAAATATGGGGAAATGG + Intergenic
1031004920 7:116459430-116459452 AAGAAGGAAATATGGGGAAATGG - Intronic
1031296897 7:120013013-120013035 AAGAAGGAAATATGGGGAAATGG - Intergenic
1031354945 7:120778924-120778946 AAGAAGGAAATATGGGGAAATGG + Intergenic
1031400229 7:121319482-121319504 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1031422162 7:121565397-121565419 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1031686094 7:124732953-124732975 AAGAAGGAAATATGGGGAAATGG - Intergenic
1031697780 7:124880096-124880118 ATGTCACATTTGTGGGGAAAAGG - Intronic
1031704320 7:124962205-124962227 ATGAAGGAAATATAGGGAAATGG + Intergenic
1031727695 7:125260690-125260712 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1031776564 7:125913919-125913941 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1032179464 7:129663190-129663212 AAGGGGGAAATGTGGGGAAAAGG - Intronic
1032198989 7:129805715-129805737 ATGAAGGAGTAGTGGGGACAGGG + Intergenic
1032308043 7:130755173-130755195 AGGTGGGAATGGAGGGGAAATGG - Intergenic
1032522105 7:132553260-132553282 ATAAAGGAAGTGTGGGGACATGG + Intronic
1032629692 7:133635319-133635341 TTGTGGGATTTGTGGGGAGAAGG + Intronic
1033084951 7:138332790-138332812 AAGAAGGAAATATGGGGAAATGG - Intergenic
1033494113 7:141876783-141876805 ATGGGGGTCTTGTGGGGAAAAGG + Intergenic
1033625812 7:143108585-143108607 AAGAAGGAAATATGGGGAAATGG - Intergenic
1033909220 7:146245169-146245191 AAGAAGGAAATATGGGGAAATGG + Intronic
1034564213 7:151900393-151900415 AGGTAGGAAGTGTCAGGAAAGGG - Intergenic
1034582001 7:152051691-152051713 ATATAGTATTTCTGGGGAAAAGG - Intronic
1036373532 8:8181026-8181048 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1036420274 8:8588972-8588994 ATGTAGAATTTGTGGGGGGAGGG + Intergenic
1036439238 8:8765675-8765697 ATGAAGGAATTCTTAGGAAAGGG + Intergenic
1036472085 8:9061224-9061246 AGGAAGGAAATATGGGGAAATGG + Intronic
1036496624 8:9276053-9276075 AGGTAGGAAGTGAGGGAAAAAGG - Intergenic
1036549957 8:9807022-9807044 AAGAAGGAAATATGGGGAAATGG - Intergenic
1036704709 8:11038431-11038453 ACGAATAAATTGTGGGGAAAAGG + Intronic
1036877370 8:12484615-12484637 AAGAAGGAAATATGGGGAAATGG + Intergenic
1037477939 8:19276012-19276034 ATGGAGAAATTGTAGTGAAAGGG - Intergenic
1037635979 8:20701319-20701341 CTGGAGGAATTTGGGGGAAAGGG - Intergenic
1037735734 8:21564433-21564455 ATGTGGAAAGTGTGGGGAGATGG - Intergenic
1038501263 8:28046180-28046202 ATATGGGAATAATGGGGAAAAGG - Intronic
1038705207 8:29886856-29886878 ATGTTGGAAGTGTGTGGAGATGG + Intergenic
1038923351 8:32110768-32110790 ATGTGGGGACTGTGCGGAAAGGG - Intronic
1039682068 8:39751129-39751151 ATTTAAGATTTATGGGGAAATGG + Intronic
1041651557 8:60308067-60308089 AAGAAGGAAATATGGGGAAATGG + Intergenic
1042109675 8:65367458-65367480 ATGCAGGAATTTTGGTGAAGTGG + Intergenic
1042453813 8:68977094-68977116 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1042707624 8:71678840-71678862 AAGAAGGAAATCTGGGGAAATGG - Intergenic
1043353418 8:79387891-79387913 AAGAAGGAAATATGGGGAAATGG + Intergenic
1043837977 8:85066854-85066876 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1044258369 8:90092004-90092026 AAGAAGGAAATATGGGGAAATGG + Intronic
1044922246 8:97178998-97179020 AAGAAGGAAATATGGGGAAATGG - Intergenic
1044925407 8:97204845-97204867 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1045197779 8:99947795-99947817 AAGAAGGAAATATGGGGAAATGG - Intergenic
1045281408 8:100752854-100752876 ACCTAGAAAATGTGGGGAAAAGG + Intergenic
1045404741 8:101854492-101854514 ATGCAGGAAATGAGGGGAAGTGG - Intronic
1045645030 8:104289860-104289882 AAGAAGGAAATATGGGGAAATGG - Intergenic
1046294372 8:112199750-112199772 AAGAAGGAAATGCGGGGAAATGG - Intergenic
1046386097 8:113511297-113511319 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1046440262 8:114245264-114245286 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1046443499 8:114285913-114285935 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1046512329 8:115216154-115216176 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1046559529 8:115818519-115818541 AAGAAGGAAATATGGGGAAATGG - Intergenic
1046798758 8:118401330-118401352 ATGTAGGACCTGAGGCGAAAAGG - Intronic
1047399975 8:124538290-124538312 ATGTAGGTTTTGTGGGAAATAGG - Intronic
1047493161 8:125390614-125390636 AAGGAGGAATTGAGGGGGAAAGG - Intergenic
1047699602 8:127435646-127435668 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1047829293 8:128613698-128613720 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1048097843 8:131314119-131314141 AAGAAGGAAATATGGGGAAATGG - Intergenic
1048135738 8:131744853-131744875 AAGAAGGAAATGTGGGGAAGTGG - Intergenic
1048144049 8:131823325-131823347 AAGAAGGAAATATGGGGAAATGG - Intergenic
1048168185 8:132082016-132082038 AAGAAGGAAATTTGGGGAAATGG + Intronic
1048407934 8:134141967-134141989 ATGGAAGACTTTTGGGGAAATGG - Intergenic
1048425071 8:134315895-134315917 ATGCAGTAATTGGTGGGAAATGG + Intergenic
1048585178 8:135768937-135768959 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1048763959 8:137826393-137826415 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1049717222 8:144098748-144098770 ATGTCGGACTTGTGAGGGAAGGG + Exonic
1049754571 8:144304130-144304152 ATTTGGGAATTGAGGGGAGAAGG + Intronic
1049868517 8:144955671-144955693 AAGAAGGAAATATGGGGAAATGG + Intergenic
1050117900 9:2279698-2279720 AAGAAGGAAATATGGGGAAATGG - Intergenic
1050193362 9:3053690-3053712 ATGTAAGAATTGTGGGCAATGGG - Intergenic
1051052884 9:12952271-12952293 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1051538534 9:18188182-18188204 ATGTATGTGTTGGGGGGAAAAGG - Intergenic
1052043710 9:23770368-23770390 ATGTAGACATTGAGGGGAAGGGG - Intronic
1052083960 9:24240958-24240980 ATGTAGGAATTGTAGGATTAAGG - Intergenic
1052163356 9:25291816-25291838 AAGAAGGAAATATGGGGAAATGG - Intergenic
1052653595 9:31330332-31330354 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1053058309 9:35007621-35007643 AAGAAGGAAATATGGGGAAATGG - Intergenic
1053144162 9:35700739-35700761 ATATAGGAATGGTGAAGAAAAGG + Intronic
1053493485 9:38529884-38529906 AGGTGGGATTTGGGGGGAAAAGG - Intergenic
1054807196 9:69406324-69406346 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1055233319 9:74089587-74089609 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1055298060 9:74853417-74853439 AAGGGGGAAATGTGGGGAAAAGG + Intronic
1055520807 9:77079416-77079438 ATGGAGGATTTTTGAGGAAAAGG + Intergenic
1055627011 9:78184948-78184970 AAGAAGGAAATATGGGGAAATGG - Intergenic
1055836258 9:80446518-80446540 GAGTAGGAATAGTGGGTAAATGG - Intergenic
1056044481 9:82702505-82702527 AAGAAGGAAATATGGGGAAATGG + Intergenic
1056061406 9:82887675-82887697 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1056239502 9:84630219-84630241 ATTTTGGTATTTTGGGGAAAGGG - Intergenic
1056324136 9:85462573-85462595 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1056522696 9:87414852-87414874 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1056883224 9:90416504-90416526 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1057106725 9:92426230-92426252 TTGTAGCAATTGGGGAGAAAAGG + Intronic
1057235094 9:93351538-93351560 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1057378242 9:94543734-94543756 AAGAAGGAAATATGGGGAAATGG - Intergenic
1057674224 9:97124698-97124720 AGGTGGGATTTGGGGGGAAAAGG - Intergenic
1057812289 9:98267392-98267414 AAGAAGGAAATATGGGGAAATGG + Intergenic
1057982337 9:99674081-99674103 AAGAAGGAAATATGGGGAAATGG - Intergenic
1058092533 9:100821622-100821644 ATATAGGAATAATTGGGAAAAGG - Intergenic
1058612676 9:106792482-106792504 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1059545921 9:115176409-115176431 AAGAAGGAAATATGGGGAAATGG + Intronic
1059574865 9:115477269-115477291 AAGAAGGAAATATGGGGAAATGG - Intergenic
1059606453 9:115840984-115841006 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1059648628 9:116293362-116293384 ATGTAGGAAATAGAGGGAAATGG + Intronic
1059845323 9:118269336-118269358 AGGTAGGTATTGGGGGGAATGGG - Intergenic
1059863206 9:118487244-118487266 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1060226458 9:121794255-121794277 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1060318221 9:122532423-122532445 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1060692089 9:125671867-125671889 CTGGAGGAATTGTGGGGGAGTGG - Intronic
1060737586 9:126076198-126076220 AAGAAGGAAATGTGGGGCAAGGG + Intergenic
1062692273 9:137848410-137848432 AAGAAGGAAATATGGGGAAATGG - Intronic
1185858173 X:3554917-3554939 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1186064416 X:5746340-5746362 ATGAAGGCATTTGGGGGAAATGG + Intergenic
1186112603 X:6273971-6273993 AAGAAGGAAATATGGGGAAATGG + Intergenic
1186340630 X:8642356-8642378 CTGAAGGAATTGGAGGGAAAGGG + Intronic
1186463864 X:9769317-9769339 AAGTGGGAATGGTGGGTAAATGG - Intronic
1186784331 X:12943754-12943776 AAGAAGGAAATATGGGGAAATGG - Intergenic
1187086269 X:16046476-16046498 AAGTAGGAAATATGGGGAAATGG + Intergenic
1187099721 X:16180967-16180989 AAGAAGGAAATATGGGGAAATGG + Intergenic
1187103524 X:16218766-16218788 AAGAAGGAAATATGGGGAAATGG + Intergenic
1188300797 X:28504210-28504232 AAGAAGGAAATATGGGGAAATGG - Intergenic
1188332756 X:28894402-28894424 AAGAAGGAAATATGGGGAAATGG + Intronic
1188405292 X:29800316-29800338 AGGAAGGAATTATGGGGAAAGGG - Intronic
1188419792 X:29979468-29979490 AAGAAGGAAATATGGGGAAATGG - Intergenic
1188431317 X:30107479-30107501 AAGAAGGAAATATGGGGAAATGG - Intergenic
1188463104 X:30450691-30450713 AAGAAGGAAATATGGGGAAATGG + Intergenic
1188552949 X:31381637-31381659 AAGAAGGAAATATGGGGAAATGG - Intronic
1188593610 X:31869642-31869664 CTTTAGATATTGTGGGGAAATGG - Intronic
1188648123 X:32594340-32594362 ATGAAGGAATTGTGGTGATGAGG + Intronic
1189156200 X:38759166-38759188 AAATAGAAATTGTGGTGAAAGGG + Intergenic
1189266781 X:39723113-39723135 CTGTAGAAGATGTGGGGAAAGGG + Intergenic
1191013950 X:55790275-55790297 AAGAAGGAAATATGGGGAAATGG + Intergenic
1191761592 X:64653203-64653225 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1191805528 X:65131306-65131328 AAGAAGGAAATATGGGGAAATGG + Intergenic
1191825863 X:65364036-65364058 AAGAAGGAAATATGGGGAAATGG - Intergenic
1192548759 X:72036931-72036953 ATGTTGGAATTATTGGGCAAAGG - Intergenic
1193188374 X:78539733-78539755 ATGAAGAACTTGTTGGGAAATGG - Intergenic
1193769701 X:85574184-85574206 AGGTAGTCAATGTGGGGAAAGGG + Intergenic
1193941746 X:87685821-87685843 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1194293366 X:92102029-92102051 AAGAAGGAAATATGGGGAAATGG + Intronic
1194308290 X:92274856-92274878 AAGAAGGAAATATGGGGAAATGG + Intronic
1194367353 X:93026853-93026875 AAGAAGGAAATATGGGGAAATGG - Intergenic
1194502730 X:94700606-94700628 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1194660967 X:96628168-96628190 AAGAAGGAAATATGGGGAAATGG - Intergenic
1194675269 X:96786340-96786362 ATGAAGGTACTGTGGAGAAAGGG + Intronic
1194822524 X:98526049-98526071 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1194873511 X:99161027-99161049 AAGAAGGAAATATGGGGAAATGG + Intergenic
1195016811 X:100789046-100789068 AAGAAGGAAATATGGGGAAATGG + Intergenic
1195841742 X:109182344-109182366 AAGAAGGAAATATGGGGAAATGG - Intergenic
1196073334 X:111547850-111547872 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1196165795 X:112534539-112534561 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1196220733 X:113110503-113110525 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1196226957 X:113178578-113178600 AAGGAGGAAATATGGGGAAATGG + Intergenic
1196300274 X:114044119-114044141 AAGGAGGAAATATGGGGAAATGG - Intergenic
1196331075 X:114470689-114470711 AAGAAGGAAATTTGGGGAAATGG - Intergenic
1196341468 X:114603079-114603101 AAGAAGGAAATTTGGGGAAATGG + Intronic
1196392388 X:115221836-115221858 ATGTAGAAGATGAGGGGAAAGGG + Intronic
1196525220 X:116722743-116722765 AAGAAGGAAATATGGGGAAATGG + Intergenic
1196533302 X:116814273-116814295 AAGAAGGAAATTTGGGGAAATGG + Intergenic
1196553121 X:117054110-117054132 CTCTAGGCATTGTGGGGACAGGG - Intergenic
1196572747 X:117283067-117283089 AAGAAGGAAATATGGGGAAATGG - Intergenic
1196773613 X:119319568-119319590 AAGAAGGAAATATGGGGAAATGG + Intergenic
1197351807 X:125390640-125390662 AAGAAGGAAATATGGGGAAATGG + Intergenic
1197406526 X:126060001-126060023 ATGTATGAAATTTGGGGGAATGG - Intergenic
1197471255 X:126867212-126867234 AAGAAGGAAATATGGGGAAATGG - Intergenic
1197933344 X:131715994-131716016 AAGAAGGAAATATGGGGAAATGG - Intergenic
1198005254 X:132487522-132487544 ATTTAGCAAGTGTGTGGAAAGGG - Intronic
1198486163 X:137089588-137089610 ATCTATGGAATGTGGGGAAAGGG + Intergenic
1198598697 X:138262729-138262751 AAGAAGGAAATATGGGGAAATGG - Intergenic
1198613956 X:138433651-138433673 TTGTAGAAATTTAGGGGAAAAGG - Intergenic
1199408571 X:147492689-147492711 ATGAAGTAGTTGTGTGGAAATGG + Intergenic
1199576729 X:149319583-149319605 AAGAAGGAAATATGGGGAAATGG - Intergenic
1199835438 X:151585530-151585552 TTGCAGGAATTGAGGTGAAAGGG + Intronic
1200532600 Y:4357193-4357215 AAGAAGGAAATATGGGGAAATGG + Intergenic
1200610885 Y:5326575-5326597 AAGAAGGAAATATGGGGAAATGG + Intronic
1200675565 Y:6143112-6143134 AAGAAGGAAATATGGGGAAATGG - Intergenic
1200813121 Y:7504871-7504893 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1201581618 Y:15516303-15516325 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1201891514 Y:18948128-18948150 AAGAAGGAAATATGGGGAAAAGG + Intergenic
1201937423 Y:19423271-19423293 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1202030189 Y:20563519-20563541 TTGAAGTAATTGTGGGGTAAAGG + Intergenic
1202076236 Y:21040498-21040520 AAGAAGGAAATGTGGGGAGATGG + Intergenic