ID: 910369325

View in Genome Browser
Species Human (GRCh38)
Location 1:86499098-86499120
Sequence AGTGACTCCTGGGGAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910369318_910369325 6 Left 910369318 1:86499069-86499091 CCTTTGACAAACTCCATTTTCTG 0: 1
1: 0
2: 1
3: 43
4: 312
Right 910369325 1:86499098-86499120 AGTGACTCCTGGGGAAGAACTGG 0: 1
1: 0
2: 1
3: 16
4: 250
910369321_910369325 -7 Left 910369321 1:86499082-86499104 CCATTTTCTGGGTAGCAGTGACT 0: 1
1: 0
2: 0
3: 21
4: 210
Right 910369325 1:86499098-86499120 AGTGACTCCTGGGGAAGAACTGG 0: 1
1: 0
2: 1
3: 16
4: 250
910369317_910369325 15 Left 910369317 1:86499060-86499082 CCAAACTGTCCTTTGACAAACTC 0: 1
1: 0
2: 0
3: 16
4: 288
Right 910369325 1:86499098-86499120 AGTGACTCCTGGGGAAGAACTGG 0: 1
1: 0
2: 1
3: 16
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910369325 Original CRISPR AGTGACTCCTGGGGAAGAAC TGG Intronic
902801155 1:18831042-18831064 AGGGTCTCCTGGGGAAGCCCAGG + Intergenic
902872405 1:19322381-19322403 ACTGAGTCCTAGGGAAGACCAGG - Intronic
903951756 1:26999686-26999708 TGGGACTCCTGGGGAAGCAGAGG - Intronic
903971012 1:27118816-27118838 ACAGACTGCTGGGGTAGAACTGG - Intronic
904207325 1:28863554-28863576 AGTGACTCCAGGAGAGGAGCGGG + Exonic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
905565496 1:38961177-38961199 ACTGACTTCTGGGGAAGGAAGGG + Intergenic
905951575 1:41955892-41955914 AGTTATTTCTGGGGAAGATCTGG + Intronic
907670718 1:56472803-56472825 AGTGACTCCAGGGCAATATCTGG + Intergenic
910369325 1:86499098-86499120 AGTGACTCCTGGGGAAGAACTGG + Intronic
911832489 1:102570654-102570676 AGTGAATCTTGGGGAAGAATTGG - Intergenic
912184091 1:107253599-107253621 ATTGCCTTCTGGGGAAGAGCAGG - Intronic
913382118 1:118223802-118223824 AGTGAGACCTAGAGAAGAACAGG + Intergenic
913525329 1:119686437-119686459 AGTGTGCCCTGGAGAAGAACAGG + Intronic
914747980 1:150513308-150513330 CCTGAGTCCTGGGGATGAACAGG + Exonic
915298273 1:154937013-154937035 ACTGACACCCGGGGAGGAACCGG + Intergenic
916471258 1:165125133-165125155 CTTGACTTCTGGGGAAGAAAGGG - Intergenic
916973047 1:170044711-170044733 AGTCAGTCCTGGGGAAAAAGAGG - Intronic
918756635 1:188345913-188345935 GGTGAGTCCTGGGGCTGAACTGG - Intergenic
922120608 1:222664020-222664042 AGGGACTCCTGGGAAAGGAGGGG - Exonic
923100332 1:230809268-230809290 AGAGGCCCCTGGGGAAGACCTGG - Intergenic
923180395 1:231512596-231512618 AATGAGTCCTTGGGGAGAACAGG + Intergenic
923503099 1:234582701-234582723 AGAGCCTCCTGGGGAGGAATGGG - Intergenic
923701750 1:236306428-236306450 TGTGACTTCTGGGCAAGGACAGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924603693 1:245513994-245514016 AGTGTCTCCAGTGGAAGAAGTGG - Intronic
1062954795 10:1532989-1533011 TGTTACTCCAGGGGAAGGACAGG + Intronic
1065564571 10:26995861-26995883 ACTGAGTCCTGGGGAAAAATTGG + Intronic
1067565523 10:47333514-47333536 AGTGACTTCTGGAGAAAAATTGG - Intergenic
1068661015 10:59623469-59623491 AGTGACTACTGGGGAGAAAATGG - Intergenic
1069551002 10:69364127-69364149 AGTGACTGCAGGGGCAGAAGGGG + Intronic
1072237522 10:93466137-93466159 AGAGACACCTGGGGGAGCACAGG + Intronic
1073286168 10:102390060-102390082 AGTGAGTCATGGGGAATATCTGG - Intergenic
1074507027 10:114080121-114080143 AGAGACTCCTGGGAAAGAGAAGG - Intergenic
1075152998 10:119951978-119952000 AGTGACTTCTAGTAAAGAACTGG + Intergenic
1077101220 11:823461-823483 AGGGATTCCAGGGGCAGAACGGG + Intronic
1078946294 11:16071669-16071691 AGTTATTCCTGGGGAAAGACTGG - Intronic
1079937833 11:26639941-26639963 CCTGACTATTGGGGAAGAACTGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081794557 11:45810641-45810663 AGGGAGGCCTGGGGAGGAACGGG + Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083147948 11:60772770-60772792 AGTGACTCCTGGGGTGGTCCAGG - Intronic
1083298056 11:61725855-61725877 AGTGGGTTCTGGGGGAGAACAGG - Intronic
1083307725 11:61769776-61769798 AATGCCTCCTGGGGAACAAAGGG + Intronic
1083391829 11:62357049-62357071 AGAGATTCCTGGAGAAAAACTGG + Exonic
1083990865 11:66244960-66244982 GGTGGGTCCTGGGGAAAAACGGG - Intergenic
1084647932 11:70471460-70471482 AGGGACTCCGGGGAAAGAAAGGG + Intronic
1085050694 11:73378735-73378757 AGTGAAGTCTGGGGAGGAACAGG - Intronic
1086004182 11:82016391-82016413 AGTGAATACTCGGGAAGATCTGG - Intergenic
1087635886 11:100700578-100700600 ATTGACTCCTGGTGAAGATGCGG - Intronic
1089399258 11:118155030-118155052 AGGACCTCCTGGGGAAGGACAGG - Intergenic
1089509588 11:118987942-118987964 AGTGACTGCAGGAGAAGAAAAGG + Intergenic
1091972984 12:4803910-4803932 ATTGAATCCTGGGGAAGAAGGGG - Intronic
1092284505 12:7121104-7121126 AGTGCATCCTGTGGAAGAGCAGG + Intergenic
1092488222 12:8921273-8921295 AGAAAATCCTGGGGAAGAAGAGG + Intronic
1093131065 12:15392217-15392239 AGTGACCCCAGAGGAAGAAAAGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1099715756 12:86291443-86291465 AGTTACTCCCAGGGAAGATCAGG + Intronic
1101411123 12:104469410-104469432 AGTGACACTTGGGAAATAACAGG + Intronic
1103280525 12:119754488-119754510 AGTGACTCAAGGGGAGGAGCGGG + Intronic
1103886664 12:124207590-124207612 ACTGGCCCCAGGGGAAGAACTGG + Intronic
1104745256 12:131206681-131206703 AGGGGCGCCTGGGGAGGAACAGG - Intergenic
1104789080 12:131470425-131470447 AGGGGCGCCTGGGGAGGAACAGG + Intergenic
1112977684 13:105341206-105341228 ATGGATTCCTGGGGCAGAACTGG - Intergenic
1113239908 13:108326033-108326055 ACAGACTCCTGGGCAAGACCAGG - Intergenic
1114486195 14:23063480-23063502 ACTGACACCTGGGGAGGTACAGG + Exonic
1115642313 14:35342413-35342435 AGTCACTGCTGGGGAATGACAGG - Intergenic
1116051160 14:39804821-39804843 AGTGAGACCTGGGGCAGAATGGG + Intergenic
1120850022 14:89161702-89161724 AGTGACTCATGGAGAAGAAATGG - Exonic
1121109940 14:91305691-91305713 TGTGGCTCCTGGGGACCAACTGG - Intronic
1121111131 14:91313881-91313903 AGCGACTCCAGGAGGAGAACGGG - Exonic
1121455974 14:94039048-94039070 AGTCCCTGCTGGGGAAGAGCAGG + Exonic
1121892201 14:97604774-97604796 AGTGAGTCTTGGGGAAAAACTGG + Intergenic
1122245914 14:100403417-100403439 TGGGACTCCTGGGAAGGAACTGG + Intronic
1122853364 14:104548404-104548426 AGCGGCTCCTGGGGCAGAAGTGG - Intronic
1126255724 15:46623035-46623057 AGCGACAGCTTGGGAAGAACAGG + Intergenic
1126934723 15:53694157-53694179 CGTGACTCCTGTTGGAGAACTGG - Intronic
1129335266 15:74848418-74848440 AGTGGCTACTGATGAAGAACTGG + Intronic
1129649070 15:77467286-77467308 ACTGCCTCCTGAGGAAAAACAGG + Exonic
1130039799 15:80396874-80396896 AGTTACTCTTGGAGAACAACAGG - Intronic
1131184571 15:90263854-90263876 ATTGATTCATGGGGCAGAACTGG - Exonic
1132090798 15:98946655-98946677 AGGGAAGCCGGGGGAAGAACAGG + Intronic
1132872419 16:2121823-2121845 GGTGACACCTGGGGAAGTAGAGG - Intronic
1134466556 16:14483993-14484015 TGGGACTCCAGGGGAAGGACAGG - Intronic
1134551475 16:15140905-15140927 GGTGACACCTGGGGAAGTAGAGG - Intergenic
1136126437 16:28185766-28185788 AGTAACTCTTGGGGAAGCATAGG - Intronic
1139157520 16:64461614-64461636 AGTCCCTCCTGGAGAAGACCTGG - Intergenic
1139543072 16:67633246-67633268 AGTGACACCTGGGGATCAACAGG - Intronic
1139589481 16:67925653-67925675 AGTGACTCCTGGGGAGATGCTGG - Intronic
1141314832 16:82951858-82951880 TGTGGCTCCTGGGAAAGAAATGG - Intronic
1141539918 16:84712213-84712235 ACTGCCTCCTGAGGAAGGACAGG - Intronic
1142060835 16:88027980-88028002 GGTGACTCCGGGTGAAGAAGTGG + Intronic
1142243188 16:88956375-88956397 TGAGACCCCTGGGGAAGAGCAGG - Intronic
1142471010 17:163295-163317 ACCTACTCCTGGGGAAGAAATGG - Intronic
1142661862 17:1436017-1436039 ATTAATTCCTGAGGAAGAACTGG + Intronic
1146314481 17:31796440-31796462 AGGGATTCTTGGGGAGGAACTGG - Intergenic
1146540431 17:33688835-33688857 AGAGACACCTGGGGAAGTATGGG - Intronic
1146644328 17:34567053-34567075 AGTGAGTCCAGGGAAAGAACAGG - Intergenic
1146648930 17:34594288-34594310 AGTGACTCCTTGGGTGGAAAGGG - Intronic
1147403146 17:40192827-40192849 AGTGGGTTCTGGGGAAGAGCGGG + Intronic
1147560120 17:41503598-41503620 AGAGACTCCTGGGAAAGGAGAGG + Intronic
1148606960 17:48937281-48937303 GGTAACTCCTGCTGAAGAACAGG + Intronic
1148741678 17:49896897-49896919 AGGGCATCCTGGGGAAGAAGAGG - Intergenic
1149850603 17:60031521-60031543 ACCTACTCCTGGGGAAGAAATGG + Intergenic
1149859563 17:60115003-60115025 ACCTACTCCTGGGGAAGAAATGG - Intergenic
1150318174 17:64187540-64187562 AGTGGCTCTTGGTGGAGAACTGG - Intronic
1150797296 17:68248293-68248315 CGAGGCTCCTGGGGAAGAAGAGG + Exonic
1151487224 17:74408549-74408571 AGAGATCCCTGAGGAAGAACTGG + Intergenic
1152004225 17:77668109-77668131 AGGGACTCCTGTGGAGCAACAGG - Intergenic
1152831604 17:82500740-82500762 CCTGCCTCCTGGGGAAGCACTGG - Intergenic
1153376644 18:4388046-4388068 AGTGCCTAGTGGGGAAGAATCGG + Intronic
1156557667 18:38085849-38085871 AGAGATACCTGGGGAAGAAGAGG + Intergenic
1157176448 18:45456732-45456754 AAAGTCTCCTGGGGAAGAAAAGG - Intronic
1157568390 18:48696097-48696119 ACTGACAGCTGGGGAAGAAGTGG - Intronic
1157658121 18:49413147-49413169 ACTGTCTCCTTGGGAAGCACAGG - Intronic
1158836362 18:61334521-61334543 AGTTACTCTGGGGGAAGAGCCGG + Intronic
1160020333 18:75175617-75175639 GGTGAATCCAGGGGCAGAACTGG + Intergenic
1160512046 18:79458208-79458230 ACAGACTCCTGGGGGAGAGCCGG + Intronic
1162312872 19:9917581-9917603 AGGGACCCTTGGGGAGGAACTGG - Intronic
1164383452 19:27754280-27754302 AGAGACACCTGGGTAAAAACAGG - Intergenic
1164886638 19:31783920-31783942 AGGAACACCTGTGGAAGAACAGG + Intergenic
1166328904 19:42067581-42067603 AGGGACTCCTGGGGCAAATCAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925157397 2:1658365-1658387 AGAGACAGCTGGGGAGGAACCGG - Intronic
925419308 2:3698472-3698494 AGTGAAGCCTGGGGAAGAAATGG - Intronic
927884418 2:26709865-26709887 AGGGACTGCTGAGGAAGAGCGGG - Intronic
927981239 2:27376464-27376486 GGTGACTCCTGGGGAAGAAGAGG - Exonic
928020466 2:27700763-27700785 AGTGGCTCCTGGGGCTGAAGGGG - Intergenic
928575822 2:32653999-32654021 TGGGACCCTTGGGGAAGAACTGG - Intronic
932238813 2:70141925-70141947 AGTGACTGGCGGGGAAGAAGGGG + Intergenic
934526692 2:95056450-95056472 AGCGTCTCCTGGAGAAGAGCTGG + Intergenic
935191865 2:100784267-100784289 AATGAGGCCTGGGGAAGAAGGGG + Intergenic
937559623 2:123205899-123205921 GGTGACTCCTAGTGGAGAACTGG - Intergenic
937990852 2:127661548-127661570 GGTGTCTCCTGGGGGATAACTGG - Intronic
938465515 2:131522324-131522346 AGGGACTTCTGGGGAAAGACTGG + Intergenic
940284517 2:152020325-152020347 AATGGCTCCTGGGTGAGAACTGG + Intronic
940458755 2:153935848-153935870 ACTGACATCTGGGGAAGAAATGG - Intronic
940908247 2:159187729-159187751 AGTGATTCGGGGGGAAGACCTGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942211573 2:173676551-173676573 ATTGACTTCTGGGGAGGAAGAGG + Intergenic
945407359 2:209465910-209465932 AGTGAAACCTGAGGAAGATCTGG - Intronic
945802196 2:214447871-214447893 AGTGACTGCTGGGAAAGGAGGGG - Intronic
946307915 2:218866340-218866362 AGTGCCTGCTGGGGAAGAGGAGG + Intronic
946977932 2:225174159-225174181 AGTGGTCCCTGGGGATGAACTGG + Intergenic
947307513 2:228763921-228763943 CCTGCCTCCTGGGAAAGAACAGG + Intergenic
1168768552 20:398752-398774 AGTGACTCCTGAGCAAAACCAGG + Intergenic
1171338608 20:24409589-24409611 AGTGACTGCAGGAGAAGATCAGG + Intergenic
1172603966 20:36202225-36202247 AGTGCCTGCTGTGGAAGAGCTGG - Intronic
1172769421 20:37370810-37370832 AGTGTTTCCTAGAGAAGAACTGG + Intronic
1174270295 20:49363563-49363585 AATGACTACTGGGGCAGAGCAGG - Intergenic
1175257475 20:57656056-57656078 GGGGACTCCAGGGGAAGAATGGG - Intronic
1178838342 21:36117412-36117434 AAAGAGTCCTGTGGAAGAACAGG - Intergenic
1181058657 22:20271606-20271628 AGTGTCTCCTGGGGAGGGATGGG + Intronic
1181854116 22:25769984-25770006 AGAATCTCCTGGGGGAGAACAGG - Intronic
1182061337 22:27400335-27400357 TATGAGTCCTGGAGAAGAACAGG - Intergenic
1183279065 22:36922575-36922597 AGTGTCTGCTGGGGAAGGAGGGG - Intronic
1184483250 22:44760369-44760391 AGCGACTCCTGGGAAAGTCCAGG - Intronic
1185034131 22:48462433-48462455 AGAGACTCCTGGGGCTGATCAGG - Intergenic
950153956 3:10708374-10708396 CCTGACCCCTGGGGAAGAATGGG - Intergenic
951708307 3:25566017-25566039 AGTGGCTCCTGGGGCAGTGCAGG - Intronic
952325937 3:32320898-32320920 AGTAACTCCAGATGAAGAACTGG - Intronic
954398008 3:50303235-50303257 AGTGGCTCATGGGGAAGCAGGGG - Exonic
954581561 3:51706014-51706036 ACTGACACCTGTGGAAGAAAGGG + Intergenic
954653046 3:52176979-52177001 AGTGACTTCTGTGGGAGAGCCGG + Intergenic
955196799 3:56811928-56811950 GCTGACTACTGGGGAAGAAGAGG - Intronic
955616047 3:60807707-60807729 AGTTAATCCTGGGGACAAACAGG - Intronic
956159352 3:66332829-66332851 AGAGACCTCTGGGGAAGGACAGG - Intronic
957015752 3:75062989-75063011 GGGGACTTCTGGGGAAGAATGGG - Intergenic
958462666 3:94418745-94418767 AGTGATTCATGGGGAAGGCCTGG - Intergenic
961109108 3:124268689-124268711 AGTGATGTCAGGGGAAGAACAGG - Intronic
961564482 3:127753942-127753964 AGTGACCCCTGAGGAAGACAGGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
964528936 3:157646174-157646196 AGTGACTTCTGGAGATGAGCAGG + Intronic
965235296 3:166110615-166110637 AGTTACTCTTAGGGAACAACGGG - Intergenic
966140300 3:176749393-176749415 TGTGAGTCCTGAGGCAGAACTGG + Intergenic
966630463 3:182068805-182068827 AGTTACTCCTGGGCAACAAAGGG - Intergenic
967787550 3:193513849-193513871 AGTGACTCCTGAGGAAAAGAAGG - Intronic
968722121 4:2215565-2215587 AGTCACTCCTGGGGAAGGGGTGG + Intronic
968908650 4:3465851-3465873 AGTGAGTCCTGGGCCACAACTGG - Intronic
969620444 4:8276222-8276244 AGAGACTTCTGGGGCAGAGCTGG - Intronic
970238413 4:13982147-13982169 AGGGAGCCCTGGGGAGGAACAGG - Intergenic
970513628 4:16805484-16805506 AGTGTCTCCTGGGGAGGAAGAGG + Intronic
972359809 4:38316355-38316377 AGTGGCTCATGCGGAGGAACTGG - Intergenic
972675461 4:41256345-41256367 TGTGACTCCCGCGGAAGAAATGG - Intergenic
975128085 4:70804470-70804492 TGTTACTCCTGGGGAGGGACTGG - Intronic
982098853 4:151948468-151948490 AGTGATTCATGGGGAAAAAGTGG - Intergenic
982248168 4:153376589-153376611 GGTGACTCCAGGGGAATAGCAGG - Intronic
986985328 5:13494289-13494311 AGTAACTCCAGGGGAAGGAGTGG - Intergenic
987160123 5:15133055-15133077 AGCGACTCCTGGGGAAGGGGTGG - Intergenic
987261093 5:16204113-16204135 AGGGCCTCCTGGGTCAGAACTGG + Intergenic
987372702 5:17207784-17207806 AGTGGCTCCTGGGGAACACCGGG - Intronic
987739473 5:21887523-21887545 AGTGTCTCCAGAGGAAGAATGGG - Intronic
990010970 5:50997123-50997145 TGTTACTGCTGGGGAAGACCAGG + Intergenic
992620541 5:78588054-78588076 AGTGACTCAAGTGAAAGAACTGG - Intronic
993192050 5:84695750-84695772 AGTGAGTCCTAGGGCTGAACTGG + Intergenic
994720346 5:103372881-103372903 AGTGATGCCTGGGAAAGAAAAGG - Intergenic
995656970 5:114437288-114437310 AGTGCCTGCTGGAGAAAAACAGG + Intronic
996256445 5:121409702-121409724 ATTAACTTCTGGGGAAGGACAGG + Intergenic
996824584 5:127667447-127667469 ACTGACTCCTGGGAAAGAAGGGG - Intergenic
997028136 5:130090409-130090431 AGTGACTAGTGTGGAAGCACTGG - Intronic
1000133856 5:158325306-158325328 ATTGACTAGTGGGGAAGAGCTGG - Intergenic
1000338724 5:160260824-160260846 AGGGACTCCAGGTGAAGGACAGG - Intronic
1001452972 5:171840347-171840369 GTTGTCTCCTGGGGAAGAGCAGG + Intergenic
1004992324 6:21152249-21152271 AGAGACTACTGGGGAACAACTGG - Intronic
1006789482 6:36690095-36690117 AGTGCGTCCTGGGTCAGAACTGG + Intergenic
1006891288 6:37431718-37431740 AGTGACTCCTGAGGGATAAATGG + Intergenic
1007081824 6:39111306-39111328 AGTGACATCAGAGGAAGAACAGG + Intronic
1007672920 6:43571123-43571145 AGTGACTCAGGCTGAAGAACAGG - Intronic
1007688143 6:43679679-43679701 ACTGTCTCCTGGGGGAGAAGTGG + Intronic
1008155444 6:48008628-48008650 AGTTACCCATGGCGAAGAACGGG + Exonic
1009592116 6:65686246-65686268 ATTGTCTTCTGGGGAAGAGCCGG - Intronic
1010378846 6:75204888-75204910 AGTGAATGCTGGGGAAGGATAGG - Intronic
1010927176 6:81756853-81756875 CGTGGCTGCTGGGGAAGAAGTGG - Intergenic
1010985706 6:82421415-82421437 AGGCACTCCTGGTGAAGGACTGG - Intergenic
1014879175 6:126701104-126701126 AGTCAGACCTGGGGAAGAAGTGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1019031535 6:169018064-169018086 TGTGCTTCCTGGGGAAGCACAGG + Intergenic
1020093915 7:5357079-5357101 ACAGCCTGCTGGGGAAGAACAGG - Exonic
1023726849 7:43151216-43151238 AGTGTCACCTGGGGAAGAAAAGG - Intronic
1029305490 7:99616789-99616811 AGTCAATCCTGGGGAAGCCCTGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1032384396 7:131511494-131511516 TCTGAATCCTGGGGAAGAGCTGG - Intronic
1033322151 7:140349605-140349627 AGTGATACCTAGGGAATAACTGG - Intronic
1035642485 8:1194487-1194509 AGGGACCCCTGGGGATGACCTGG - Intergenic
1037809788 8:22080629-22080651 AGTGCCTCCTGGAGGGGAACAGG + Intronic
1037916199 8:22774937-22774959 AGGGGCTCCTGGGGAAGAGCTGG - Intronic
1037927745 8:22857825-22857847 AGTGAGCCATGGAGAAGAACAGG + Intronic
1039932899 8:42010863-42010885 AGTGACCCCAGAGGAAGAAAAGG - Intronic
1042544892 8:69942565-69942587 AGCCACTCCTGGGGAAAATCCGG + Intergenic
1044463528 8:92476739-92476761 AGTGATTCCAGGGAAAGAAGAGG + Intergenic
1044486186 8:92757158-92757180 TGTGCCTCCTGGGGAAGAGGTGG + Intergenic
1045676676 8:104615044-104615066 TGGGACTCCTGGGCCAGAACTGG + Intronic
1047903020 8:129444163-129444185 AGTGAGTCCTGGGGAAGCTGGGG - Intergenic
1047910045 8:129518149-129518171 GGTGACTCCTGGTGCTGAACTGG + Intergenic
1049813845 8:144588853-144588875 AGTGAATCGTGGTGAAGATCAGG + Intronic
1054773064 9:69101010-69101032 GACGACTCCTGGGGAAGAAGAGG + Intergenic
1058330912 9:103758310-103758332 AGTCACTCATGGGGAAGAAATGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059515089 9:114886523-114886545 ACTGAATCCTGGGCAAGTACAGG - Intergenic
1059648642 9:116293521-116293543 TGTGAGTTCTGGGAAAGAACTGG + Intronic
1059817398 9:117932836-117932858 AGAGACTTTTCGGGAAGAACAGG - Intergenic
1060773391 9:126349029-126349051 AGGGCCACCTGGGGAAGCACAGG + Intronic
1062274205 9:135723119-135723141 ACTGACTGCTGGGGAGGCACAGG - Intronic
1186527137 X:10258992-10259014 AGTAACACCTGAGGAAGAATTGG - Intergenic
1187058183 X:15760638-15760660 TGTGACAACTAGGGAAGAACTGG - Intronic
1189146368 X:38659257-38659279 AGAGGCTCCTGGGTAAGAAAGGG - Intronic
1189929749 X:45996429-45996451 AGTGAGTCCTAGGGATGAACTGG - Intergenic
1191234483 X:58123140-58123162 AGAGACTCCTGGCGAAAAATAGG + Intergenic
1191243836 X:58210354-58210376 AGAGACTCCTGGGCAATACCAGG + Intergenic
1191246205 X:58230224-58230246 AGAGACTCCTGGCCAAAAACAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192826803 X:74705279-74705301 GGTGAATCCTAGTGAAGAACTGG - Intergenic
1193047543 X:77068718-77068740 AGTGACACCTGGAGAAAAGCAGG + Intergenic
1193232696 X:79066727-79066749 AGTGAGTCCTAGGGTTGAACTGG - Intergenic
1193326275 X:80181548-80181570 AGTGACTCCTGGAGGGGAAAGGG - Intergenic
1193697326 X:84724607-84724629 AGTGACTCCTAGTGCTGAACTGG - Intergenic
1194652490 X:96532841-96532863 AGTGTCTCCTGGGAAAGGAAAGG + Intergenic
1196360937 X:114857186-114857208 ACAGAATCCTGGGGAAGAACGGG - Intronic
1196651144 X:118169532-118169554 AGAGAATCCTGGGGAATAAGTGG + Intergenic
1196942525 X:120791399-120791421 AGTGGCTGCTGGCCAAGAACTGG + Intergenic
1197441799 X:126500544-126500566 AGGGACTCGTGGGGAAGGATGGG - Intergenic
1198792016 X:140356201-140356223 AGTAGCTCCCGGGGAAGACCTGG - Intergenic
1199548699 X:149034725-149034747 ACTGTCTCCTGTGGAAGGACAGG - Intergenic
1199975955 X:152895057-152895079 GGTGGCTGCTGGGAAAGAACTGG - Intergenic
1200053474 X:153446615-153446637 AGTGGCTGCTGGGGAAGGAAGGG + Intronic