ID: 910372861

View in Genome Browser
Species Human (GRCh38)
Location 1:86536664-86536686
Sequence ATTAATATACTAATGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910372861_910372864 28 Left 910372861 1:86536664-86536686 CCTTTGTCCATTAGTATATTAAT No data
Right 910372864 1:86536715-86536737 TCCAATATCCCTGCCGTGTCTGG No data
910372861_910372863 -1 Left 910372861 1:86536664-86536686 CCTTTGTCCATTAGTATATTAAT No data
Right 910372863 1:86536686-86536708 TCATTTTTGTTTAAAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910372861 Original CRISPR ATTAATATACTAATGGACAA AGG (reversed) Intergenic
No off target data available for this crispr