ID: 910375248

View in Genome Browser
Species Human (GRCh38)
Location 1:86561795-86561817
Sequence AACCCTATTCTATTACTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910375242_910375248 15 Left 910375242 1:86561757-86561779 CCATATCAGTTATTGATTTTTCC 0: 1
1: 2
2: 1
3: 15
4: 326
Right 910375248 1:86561795-86561817 AACCCTATTCTATTACTGATAGG 0: 1
1: 0
2: 2
3: 16
4: 162
910375241_910375248 16 Left 910375241 1:86561756-86561778 CCCATATCAGTTATTGATTTTTC 0: 1
1: 0
2: 1
3: 37
4: 474
Right 910375248 1:86561795-86561817 AACCCTATTCTATTACTGATAGG 0: 1
1: 0
2: 2
3: 16
4: 162
910375240_910375248 17 Left 910375240 1:86561755-86561777 CCCCATATCAGTTATTGATTTTT 0: 1
1: 0
2: 2
3: 37
4: 576
Right 910375248 1:86561795-86561817 AACCCTATTCTATTACTGATAGG 0: 1
1: 0
2: 2
3: 16
4: 162
910375243_910375248 -6 Left 910375243 1:86561778-86561800 CCCGTATCCCACACCTCAACCCT 0: 1
1: 0
2: 0
3: 14
4: 195
Right 910375248 1:86561795-86561817 AACCCTATTCTATTACTGATAGG 0: 1
1: 0
2: 2
3: 16
4: 162
910375244_910375248 -7 Left 910375244 1:86561779-86561801 CCGTATCCCACACCTCAACCCTA 0: 1
1: 0
2: 1
3: 22
4: 346
Right 910375248 1:86561795-86561817 AACCCTATTCTATTACTGATAGG 0: 1
1: 0
2: 2
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910375248 Original CRISPR AACCCTATTCTATTACTGAT AGG Intronic
901914794 1:12490251-12490273 AACCCTATGCTAGTAGAGATTGG - Intronic
903763785 1:25719003-25719025 AAACCTCATATATTACTGATAGG - Intronic
904676390 1:32201505-32201527 AACCCTATTCTATTTATCAGGGG - Intronic
904922883 1:34022553-34022575 AGCCCTATTCTATTACCTCTTGG - Intronic
906997663 1:50814907-50814929 AACCCTTTTGTACTGCTGATGGG + Intronic
907260244 1:53212496-53212518 AACCTTTTTCTATTACTGATTGG + Intronic
907302709 1:53498590-53498612 CACACTGCTCTATTACTGATGGG - Intergenic
908122101 1:60995843-60995865 AACCCTCATATATTACTGATGGG + Intronic
909914969 1:81305668-81305690 AACCCAATTGTACTACTGAATGG - Intergenic
909931608 1:81504331-81504353 AGCCCTCTTCTATTTCTTATGGG + Intronic
910375248 1:86561795-86561817 AACCCTATTCTATTACTGATAGG + Intronic
912025516 1:105165991-105166013 AATCCTATTCTATTTGTTATTGG - Intergenic
915401272 1:155623688-155623710 CACCCAATTCTCTTACTGTTGGG - Intergenic
919099777 1:193080287-193080309 AACCCTAGTGTATTTCTGGTGGG + Intronic
919117429 1:193298095-193298117 AACTCTCATTTATTACTGATGGG + Intergenic
919442729 1:197657617-197657639 AACCCTTGTACATTACTGATGGG + Intronic
921216454 1:212941510-212941532 ATCCCACTTCTAGTACTGATAGG - Intergenic
921326802 1:213993215-213993237 AACCCAAATGTATTATTGATCGG - Intronic
924596766 1:245452547-245452569 AACCCTGGTATATTGCTGATGGG - Intronic
1063773452 10:9231220-9231242 AACCATGTTCTTTTACTCATTGG - Intergenic
1063855921 10:10253784-10253806 AACCCTATTCTCTTAATGTGAGG - Intergenic
1064657767 10:17573036-17573058 AACTCCAATCTATGACTGATGGG + Intergenic
1065620092 10:27571947-27571969 TTACCTATTCTCTTACTGATAGG + Intergenic
1067892096 10:50146089-50146111 AACCCTCATCTACTGCTGATGGG - Intergenic
1068098124 10:52517530-52517552 ACATCTATTTTATTACTGATGGG + Intergenic
1069006662 10:63325293-63325315 AACCCTATTCTAGTATTCTTGGG - Intronic
1069428565 10:68312520-68312542 AACCCTATTCTATTAAAAAATGG - Intronic
1072250737 10:93580582-93580604 ATACCTATTCTATTACTGTGTGG - Intronic
1072263857 10:93708463-93708485 AACCCTATACCATTAATCATAGG - Intergenic
1072467309 10:95677834-95677856 AACCCTATTATATTCCTGCATGG - Intronic
1075705927 10:124500780-124500802 AACCCTTCTCTATTGCTGCTGGG + Intronic
1078000193 11:7488039-7488061 AATCCTTTTCTATAAATGATAGG + Intronic
1085084520 11:73657817-73657839 ATCCCTATTGGATCACTGATGGG + Intronic
1087374506 11:97325014-97325036 AAACCAAATCTATGACTGATTGG - Intergenic
1090301652 11:125646584-125646606 AACCCTCTTACATTACTGATGGG - Intronic
1090614729 11:128504594-128504616 AAACCTTTTCTTTTACTGGTGGG + Intronic
1090891598 11:130928336-130928358 AACCCTATCATATTACTGATAGG - Intergenic
1093766063 12:22964181-22964203 AAGCCTCTGCTATTACTGTTGGG + Intergenic
1094172381 12:27507012-27507034 AATCCTATTATATTGCTGGTGGG + Intergenic
1094242566 12:28245888-28245910 AACCCAATTATTTTACTCATAGG + Intronic
1096442711 12:51658909-51658931 AACCCTCTTATATTGCTGGTAGG + Intronic
1099441254 12:82702453-82702475 AAACAAATTCTGTTACTGATGGG + Intronic
1101644822 12:106621525-106621547 AACCCTAACCAATTAATGATTGG + Intronic
1104871570 12:132002229-132002251 AAGCCTGTTCTATTAATAATTGG + Intronic
1111370584 13:87311773-87311795 AAGCCTGTACTCTTACTGATGGG - Intergenic
1114204193 14:20552905-20552927 AACCCTAGTGCACTACTGATTGG + Intergenic
1115054854 14:29111110-29111132 AACTCTATTTTTTTCCTGATAGG - Intergenic
1116130394 14:40848644-40848666 AAACCTGTTCTATTATTGAAAGG + Intergenic
1116939928 14:50781192-50781214 AACCCTATTTTATTTGTCATAGG - Intronic
1118509089 14:66450762-66450784 AACCTTATTCTATCTCTGCTAGG - Intergenic
1124040803 15:26101395-26101417 AACTCTAATCTATTACCTATGGG + Intergenic
1125218883 15:37310104-37310126 TATCCTTTTCTATGACTGATTGG - Intergenic
1126323278 15:47447730-47447752 AACCCCAATTTATTGCTGATTGG + Intronic
1127361914 15:58251896-58251918 AACCCCTTTATATTACAGATGGG + Intronic
1127687142 15:61358915-61358937 TGCCCTATACTATTTCTGATGGG + Intergenic
1128886879 15:71296266-71296288 AACCCTTATCTATTGTTGATGGG - Intronic
1129167352 15:73786387-73786409 AATCCTATACTATTACTGGGAGG - Intergenic
1129295269 15:74596633-74596655 AGCCCTCTTCTATTTCTTATGGG + Exonic
1130638162 15:85644833-85644855 AACCCAAGTCCATTACTGAGTGG - Intronic
1131904123 15:97123016-97123038 AACTCTCATTTATTACTGATGGG + Intergenic
1131970800 15:97891181-97891203 TACCCTATTCTATTGCTTCTTGG - Intergenic
1137639574 16:50016693-50016715 AATCCTTATCTATTACTTATGGG - Intergenic
1144445587 17:15324543-15324565 AACCCTAATACATTGCTGATGGG - Intronic
1150460855 17:65349496-65349518 AACTTTATTCTCTTACTGCTGGG - Intergenic
1151250005 17:72826879-72826901 AACCCTCCTATATTGCTGATAGG + Intronic
1153338189 18:3946550-3946572 TACACTATTATATTAGTGATGGG + Intronic
1154336410 18:13469264-13469286 AACCCCTTTTTATTACTGATAGG + Intronic
1155377566 18:25177147-25177169 TACCCTATTTTATGACTGCTAGG + Intronic
1155463720 18:26112563-26112585 AGACCAATTCTATGACTGATTGG - Intergenic
1156996048 18:43468159-43468181 AACCCTATTTTATTGCAGAAAGG + Intergenic
1157069754 18:44392115-44392137 AATCCTATTCTATTCCCAATTGG + Intergenic
1157212128 18:45752659-45752681 AACCCTTTTCAATTTCAGATTGG + Intergenic
1157698959 18:49747368-49747390 AACCCTGATTTATAACTGATTGG + Intergenic
1158094675 18:53757093-53757115 AACACTTTTTTATTACTGGTAGG - Intergenic
1166251530 19:41574720-41574742 AACCCTCGTATATTGCTGATGGG + Intronic
927068711 2:19502019-19502041 ATATGTATTCTATTACTGATGGG + Intergenic
927618898 2:24630404-24630426 TACCAGATTCTATTATTGATGGG + Intronic
927626130 2:24720833-24720855 AACCAGAGTCTATTATTGATTGG + Intronic
928386142 2:30869968-30869990 AACCCTCGTCCATTGCTGATAGG - Intergenic
928799932 2:35076399-35076421 ACCCCTATTAAAATACTGATAGG - Intergenic
931211377 2:60199455-60199477 AACTCTAATCAATTACTGCTTGG - Intergenic
932499089 2:72165965-72165987 AACCCTCATATATTGCTGATGGG + Intergenic
932939714 2:76149389-76149411 CACCCCATTCTAGTCCTGATTGG + Intergenic
936111202 2:109666623-109666645 AACTTTATTCTGTTTCTGATAGG - Intergenic
936394272 2:112108921-112108943 AACCCTCATATATTGCTGATAGG - Intronic
936593472 2:113825624-113825646 AGCCCAGTTCTATTACTGAAAGG - Intergenic
937963204 2:127479620-127479642 AATCCTATTCTGATACGGATTGG - Intronic
938963648 2:136365695-136365717 AACCCTCATATATTACTGGTAGG - Intergenic
939545190 2:143543154-143543176 AACCCTTTTATATTATTGGTGGG - Intronic
943113210 2:183633104-183633126 AACCCTGTTCAATTTCTGACTGG + Intergenic
944257090 2:197634607-197634629 AATCCTATTCTTTAACTGATAGG - Intronic
945920860 2:215753359-215753381 AAGACTATGCTTTTACTGATCGG - Intergenic
1170077493 20:12435628-12435650 AACACTGTTTTATTACTGAGGGG - Intergenic
1170170672 20:13407688-13407710 AACCCTCATATATCACTGATAGG - Intronic
1170249404 20:14263615-14263637 AACCCTATTATAATAGTCATGGG - Intronic
1178481697 21:32984904-32984926 AACCCTCGTATATTGCTGATGGG + Intergenic
1180111340 21:45655375-45655397 AACCCTCATAAATTACTGATGGG - Intronic
1182672149 22:32005395-32005417 AACCCTCTTCTGTTACTCATGGG - Intergenic
949274172 3:2258349-2258371 AAGCCCAGTCTATCACTGATGGG - Intronic
950170578 3:10836461-10836483 AACCCTCGTATATTACTGGTGGG - Intronic
951385717 3:22039850-22039872 CACCCTTTTCTATGACTGAAAGG + Intronic
954339770 3:49943831-49943853 AACCCTTGTGTATTACTGGTGGG - Intronic
956954868 3:74325561-74325583 ACCCCTTTACTAGTACTGATAGG + Intronic
958962498 3:100523400-100523422 AACCCTATTCAATAAATGCTGGG + Intronic
960823114 3:121755227-121755249 AACTCACATCTATTACTGATGGG + Intergenic
965356388 3:167679307-167679329 AACCCTAATATATTGTTGATGGG + Intergenic
965938061 3:174139722-174139744 AACCCTCTTTTATTGCTGGTGGG - Intronic
966722381 3:183077350-183077372 AACCCTTCTATGTTACTGATGGG - Intronic
967205451 3:187116035-187116057 AAGCCTATTATGTTTCTGATTGG + Intergenic
973967413 4:56178122-56178144 AACTCTCATATATTACTGATGGG + Intronic
976276212 4:83281416-83281438 TACCGTATTCACTTACTGATAGG + Intronic
976284017 4:83353952-83353974 AACCCTCATATATTGCTGATGGG - Intergenic
976673746 4:87682086-87682108 AATCCTTTTCTATTTCTTATTGG - Intergenic
977024107 4:91793568-91793590 AAGCATGTTCTATTACTGTTTGG - Intergenic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
981460070 4:145003272-145003294 AAATCTACTCTACTACTGATGGG + Intronic
982704513 4:158692598-158692620 AACCATATTCTTTTACTGAGAGG - Intronic
983184022 4:164680429-164680451 AACCCTTGTACATTACTGATGGG - Intergenic
983749484 4:171247976-171247998 AACACTTTTATATTGCTGATGGG - Intergenic
986041973 5:4002303-4002325 GACCCTATTCCATTATTGATTGG - Intergenic
986270853 5:6229490-6229512 AACCATTTTCTATTATTCATTGG + Intergenic
986552706 5:8976166-8976188 AAACCTATTCGACTAGTGATAGG + Intergenic
988166928 5:27604770-27604792 AACATTAATCTATTACTTATGGG + Intergenic
988895274 5:35665520-35665542 AAAGCTATACTATTACTGGTAGG + Intronic
992997952 5:82350758-82350780 AACCCTATCAAATTAATGATTGG - Intronic
993109731 5:83642487-83642509 AACACTATTCAATAAGTGATCGG - Intronic
994253185 5:97561283-97561305 AACACTATTATGTTACTGAAAGG - Intergenic
994552248 5:101251171-101251193 AACCCTTTTATATTGCTGGTGGG + Intergenic
995643813 5:114288435-114288457 AACCCTCATATGTTACTGATGGG - Intergenic
997007634 5:129837393-129837415 AACCCTCATATATTATTGATAGG - Intergenic
998589945 5:143466249-143466271 AACCCTCTTACATTGCTGATGGG - Intergenic
1001074564 5:168615882-168615904 AATCCTTTTGTATTACTGATGGG - Intergenic
1004419687 6:15457783-15457805 AACCCTATACTATTAATACTGGG + Intronic
1004426370 6:15509957-15509979 CAACATATTCTGTTACTGATTGG - Intronic
1006559908 6:34901968-34901990 AGGCCTATTCTATTACTGTTAGG - Intronic
1008356683 6:50563079-50563101 AACTCTATTATTTTACAGATAGG - Intergenic
1009242752 6:61200765-61200787 AACCCTATCCAATTTCTGATGGG - Intergenic
1009668700 6:66716970-66716992 AACCCTCATATATTGCTGATGGG + Intergenic
1009903631 6:69841080-69841102 AACCCTTATATATTGCTGATGGG - Intergenic
1011170662 6:84501160-84501182 AAACATATTCTAATACTTATTGG - Intergenic
1015294705 6:131577285-131577307 AACCCTCATATATTTCTGATGGG + Intronic
1017244853 6:152212742-152212764 AACCCTAATACATTGCTGATGGG - Intronic
1017698310 6:157041696-157041718 ATCCCAGTTCTGTTACTGATTGG - Intronic
1022591380 7:31667006-31667028 ACCCCTGTTCTATTAGGGATAGG + Intergenic
1026884396 7:73930182-73930204 AACCCTCATCTATTGCTGGTGGG - Intergenic
1027186468 7:75974119-75974141 AACCCTGTCCTATTAAAGATGGG + Intronic
1027375472 7:77544123-77544145 AACCCTCATATATTCCTGATTGG - Intronic
1027536310 7:79406469-79406491 ATCTCTATTCTTTCACTGATAGG - Intronic
1030946485 7:115728407-115728429 AACCCACTTGTATTACTGAAAGG + Intergenic
1036666433 8:10745953-10745975 AACCCTTGTGTATTACTGGTGGG - Intronic
1039261402 8:35775627-35775649 AACCTTATTTTCTTACTGTTTGG + Intronic
1041528563 8:58836716-58836738 AACCCTATGAAATTAATGATGGG - Intronic
1043551617 8:81379436-81379458 ATCCCTATTCTCATATTGATTGG - Intergenic
1043622358 8:82210996-82211018 TACCATATTCTATTACTGAAAGG - Intergenic
1043680359 8:83017527-83017549 AACCCTTCTCTATCTCTGATTGG - Intergenic
1044120909 8:88393790-88393812 AAAACTATTTTATTACTGATAGG - Intergenic
1044450838 8:92334511-92334533 AAACCAAATCTATGACTGATTGG - Intergenic
1046504791 8:115123623-115123645 AACCCAGTTCTATTATTTATGGG - Intergenic
1049634641 8:143680990-143681012 CACCCGATTCTATCGCTGATCGG + Intergenic
1055463754 9:76543670-76543692 AACCCTATTTTTTTAATGATGGG + Intergenic
1056022954 9:82460379-82460401 AACCCTATTAGATTGCTGACGGG - Intergenic
1059435385 9:114272953-114272975 AACCCTCTTCAGTTACAGATGGG - Intronic
1186550429 X:10499053-10499075 AACCCTCATGTATTTCTGATGGG - Intronic
1186677909 X:11839212-11839234 AACCCTTATATACTACTGATGGG - Intergenic
1187293847 X:17980192-17980214 AATTCCATTCTATCACTGATGGG - Intergenic
1187908269 X:24087291-24087313 AACCCTGCTCTATTGTTGATAGG - Intergenic
1191888116 X:65910367-65910389 AACCCTTGTATATTGCTGATGGG - Intergenic
1192299856 X:69889058-69889080 AACCCTTGTCTATTGCTGGTGGG - Intronic
1192749586 X:73975510-73975532 AACCCTCATATATTGCTGATAGG - Intergenic
1193906558 X:87252574-87252596 AACCCTATTACATTGCTTATAGG - Intergenic
1195736430 X:108017350-108017372 AACCTCATACTAATACTGATGGG - Intergenic
1195774982 X:108393015-108393037 AACCTTAGTATATTGCTGATGGG + Intronic
1196096089 X:111801502-111801524 AACCCTCGTATATTGCTGATGGG - Intronic
1196128758 X:112129223-112129245 AACCCTTTTGTATTGCTGATGGG + Intergenic
1196530283 X:116778552-116778574 TAATCTAGTCTATTACTGATGGG - Intergenic
1196682158 X:118480417-118480439 AACCCTTGTATATTACTGGTGGG - Intergenic
1197890001 X:131260229-131260251 AACCATATCTTATTACTGATTGG - Intergenic
1198473746 X:136975323-136975345 AACCCTAATACATTACTGATAGG - Intergenic
1199751302 X:150821901-150821923 AACCCTCATACATTACTGATGGG + Intronic