ID: 910389135

View in Genome Browser
Species Human (GRCh38)
Location 1:86719596-86719618
Sequence ATTGATGCAGGGACTGAGTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910389132_910389135 1 Left 910389132 1:86719572-86719594 CCAGAACTTTTGGGACAATATAT 0: 1
1: 0
2: 1
3: 14
4: 179
Right 910389135 1:86719596-86719618 ATTGATGCAGGGACTGAGTTTGG 0: 1
1: 0
2: 1
3: 21
4: 171
910389131_910389135 2 Left 910389131 1:86719571-86719593 CCCAGAACTTTTGGGACAATATA 0: 1
1: 0
2: 3
3: 13
4: 217
Right 910389135 1:86719596-86719618 ATTGATGCAGGGACTGAGTTTGG 0: 1
1: 0
2: 1
3: 21
4: 171
910389128_910389135 19 Left 910389128 1:86719554-86719576 CCAAGTCGTATAAACAACCCAGA 0: 1
1: 0
2: 0
3: 11
4: 157
Right 910389135 1:86719596-86719618 ATTGATGCAGGGACTGAGTTTGG 0: 1
1: 0
2: 1
3: 21
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910389135 Original CRISPR ATTGATGCAGGGACTGAGTT TGG Exonic