ID: 910395439

View in Genome Browser
Species Human (GRCh38)
Location 1:86789145-86789167
Sequence TTGCACTCCTCTATGAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910395439_910395453 29 Left 910395439 1:86789145-86789167 CCGGCCCTCATAGAGGAGTGCAA No data
Right 910395453 1:86789197-86789219 GGAGCTGTGGTACCGGGGCGGGG No data
910395439_910395449 23 Left 910395439 1:86789145-86789167 CCGGCCCTCATAGAGGAGTGCAA No data
Right 910395449 1:86789191-86789213 CGGCATGGAGCTGTGGTACCGGG No data
910395439_910395447 16 Left 910395439 1:86789145-86789167 CCGGCCCTCATAGAGGAGTGCAA No data
Right 910395447 1:86789184-86789206 GTGTGCACGGCATGGAGCTGTGG No data
910395439_910395450 24 Left 910395439 1:86789145-86789167 CCGGCCCTCATAGAGGAGTGCAA No data
Right 910395450 1:86789192-86789214 GGCATGGAGCTGTGGTACCGGGG No data
910395439_910395454 30 Left 910395439 1:86789145-86789167 CCGGCCCTCATAGAGGAGTGCAA No data
Right 910395454 1:86789198-86789220 GAGCTGTGGTACCGGGGCGGGGG No data
910395439_910395452 28 Left 910395439 1:86789145-86789167 CCGGCCCTCATAGAGGAGTGCAA No data
Right 910395452 1:86789196-86789218 TGGAGCTGTGGTACCGGGGCGGG No data
910395439_910395445 8 Left 910395439 1:86789145-86789167 CCGGCCCTCATAGAGGAGTGCAA No data
Right 910395445 1:86789176-86789198 GCAGTTCCGTGTGCACGGCATGG No data
910395439_910395448 22 Left 910395439 1:86789145-86789167 CCGGCCCTCATAGAGGAGTGCAA No data
Right 910395448 1:86789190-86789212 ACGGCATGGAGCTGTGGTACCGG No data
910395439_910395451 27 Left 910395439 1:86789145-86789167 CCGGCCCTCATAGAGGAGTGCAA No data
Right 910395451 1:86789195-86789217 ATGGAGCTGTGGTACCGGGGCGG No data
910395439_910395444 3 Left 910395439 1:86789145-86789167 CCGGCCCTCATAGAGGAGTGCAA No data
Right 910395444 1:86789171-86789193 TGAGGGCAGTTCCGTGTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910395439 Original CRISPR TTGCACTCCTCTATGAGGGC CGG (reversed) Intergenic