ID: 910395446

View in Genome Browser
Species Human (GRCh38)
Location 1:86789182-86789204
Sequence ACAGCTCCATGCCGTGCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910395446_910395454 -7 Left 910395446 1:86789182-86789204 CCGTGTGCACGGCATGGAGCTGT No data
Right 910395454 1:86789198-86789220 GAGCTGTGGTACCGGGGCGGGGG No data
910395446_910395455 0 Left 910395446 1:86789182-86789204 CCGTGTGCACGGCATGGAGCTGT No data
Right 910395455 1:86789205-86789227 GGTACCGGGGCGGGGGACACAGG No data
910395446_910395451 -10 Left 910395446 1:86789182-86789204 CCGTGTGCACGGCATGGAGCTGT No data
Right 910395451 1:86789195-86789217 ATGGAGCTGTGGTACCGGGGCGG No data
910395446_910395452 -9 Left 910395446 1:86789182-86789204 CCGTGTGCACGGCATGGAGCTGT No data
Right 910395452 1:86789196-86789218 TGGAGCTGTGGTACCGGGGCGGG No data
910395446_910395457 5 Left 910395446 1:86789182-86789204 CCGTGTGCACGGCATGGAGCTGT No data
Right 910395457 1:86789210-86789232 CGGGGCGGGGGACACAGGAAAGG No data
910395446_910395453 -8 Left 910395446 1:86789182-86789204 CCGTGTGCACGGCATGGAGCTGT No data
Right 910395453 1:86789197-86789219 GGAGCTGTGGTACCGGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910395446 Original CRISPR ACAGCTCCATGCCGTGCACA CGG (reversed) Intergenic