ID: 910395454

View in Genome Browser
Species Human (GRCh38)
Location 1:86789198-86789220
Sequence GAGCTGTGGTACCGGGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910395439_910395454 30 Left 910395439 1:86789145-86789167 CCGGCCCTCATAGAGGAGTGCAA No data
Right 910395454 1:86789198-86789220 GAGCTGTGGTACCGGGGCGGGGG No data
910395446_910395454 -7 Left 910395446 1:86789182-86789204 CCGTGTGCACGGCATGGAGCTGT No data
Right 910395454 1:86789198-86789220 GAGCTGTGGTACCGGGGCGGGGG No data
910395441_910395454 25 Left 910395441 1:86789150-86789172 CCTCATAGAGGAGTGCAATGCTG No data
Right 910395454 1:86789198-86789220 GAGCTGTGGTACCGGGGCGGGGG No data
910395440_910395454 26 Left 910395440 1:86789149-86789171 CCCTCATAGAGGAGTGCAATGCT No data
Right 910395454 1:86789198-86789220 GAGCTGTGGTACCGGGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910395454 Original CRISPR GAGCTGTGGTACCGGGGCGG GGG Intergenic