ID: 910395815

View in Genome Browser
Species Human (GRCh38)
Location 1:86792857-86792879
Sequence CTGTTTGAACAGTTGCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910395815_910395822 -2 Left 910395815 1:86792857-86792879 CCCCATGGCAACTGTTCAAACAG No data
Right 910395822 1:86792878-86792900 AGCTGAGGGAAGCTTTAGGGTGG No data
910395815_910395824 12 Left 910395815 1:86792857-86792879 CCCCATGGCAACTGTTCAAACAG No data
Right 910395824 1:86792892-86792914 TTAGGGTGGAGAGTGGCGCCAGG No data
910395815_910395821 -5 Left 910395815 1:86792857-86792879 CCCCATGGCAACTGTTCAAACAG No data
Right 910395821 1:86792875-86792897 AACAGCTGAGGGAAGCTTTAGGG No data
910395815_910395820 -6 Left 910395815 1:86792857-86792879 CCCCATGGCAACTGTTCAAACAG No data
Right 910395820 1:86792874-86792896 AAACAGCTGAGGGAAGCTTTAGG No data
910395815_910395823 5 Left 910395815 1:86792857-86792879 CCCCATGGCAACTGTTCAAACAG No data
Right 910395823 1:86792885-86792907 GGAAGCTTTAGGGTGGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910395815 Original CRISPR CTGTTTGAACAGTTGCCATG GGG (reversed) Intergenic
No off target data available for this crispr