ID: 910399586

View in Genome Browser
Species Human (GRCh38)
Location 1:86825405-86825427
Sequence CTGTAGTTATGGAGGAATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910399581_910399586 -9 Left 910399581 1:86825391-86825413 CCAGCCCACAAGAGCTGTAGTTA No data
Right 910399586 1:86825405-86825427 CTGTAGTTATGGAGGAATTCAGG No data
910399579_910399586 4 Left 910399579 1:86825378-86825400 CCCTGGAAGAGAGCCAGCCCACA No data
Right 910399586 1:86825405-86825427 CTGTAGTTATGGAGGAATTCAGG No data
910399580_910399586 3 Left 910399580 1:86825379-86825401 CCTGGAAGAGAGCCAGCCCACAA No data
Right 910399586 1:86825405-86825427 CTGTAGTTATGGAGGAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910399586 Original CRISPR CTGTAGTTATGGAGGAATTC AGG Intergenic
No off target data available for this crispr