ID: 910408552

View in Genome Browser
Species Human (GRCh38)
Location 1:86915210-86915232
Sequence GGCGCTGCCGCCGGAGCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910408545_910408552 8 Left 910408545 1:86915179-86915201 CCGGGCTGAGTGCTGTGGAAGGG 0: 1
1: 0
2: 5
3: 36
4: 532
Right 910408552 1:86915210-86915232 GGCGCTGCCGCCGGAGCAAGTGG 0: 1
1: 0
2: 2
3: 14
4: 123
910408543_910408552 9 Left 910408543 1:86915178-86915200 CCCGGGCTGAGTGCTGTGGAAGG 0: 1
1: 0
2: 6
3: 56
4: 790
Right 910408552 1:86915210-86915232 GGCGCTGCCGCCGGAGCAAGTGG 0: 1
1: 0
2: 2
3: 14
4: 123
910408542_910408552 10 Left 910408542 1:86915177-86915199 CCCCGGGCTGAGTGCTGTGGAAG 0: 1
1: 0
2: 0
3: 22
4: 208
Right 910408552 1:86915210-86915232 GGCGCTGCCGCCGGAGCAAGTGG 0: 1
1: 0
2: 2
3: 14
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910408552 Original CRISPR GGCGCTGCCGCCGGAGCAAG TGG Intronic