ID: 910408552

View in Genome Browser
Species Human (GRCh38)
Location 1:86915210-86915232
Sequence GGCGCTGCCGCCGGAGCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910408543_910408552 9 Left 910408543 1:86915178-86915200 CCCGGGCTGAGTGCTGTGGAAGG 0: 1
1: 0
2: 6
3: 56
4: 790
Right 910408552 1:86915210-86915232 GGCGCTGCCGCCGGAGCAAGTGG 0: 1
1: 0
2: 2
3: 14
4: 123
910408542_910408552 10 Left 910408542 1:86915177-86915199 CCCCGGGCTGAGTGCTGTGGAAG 0: 1
1: 0
2: 0
3: 22
4: 208
Right 910408552 1:86915210-86915232 GGCGCTGCCGCCGGAGCAAGTGG 0: 1
1: 0
2: 2
3: 14
4: 123
910408545_910408552 8 Left 910408545 1:86915179-86915201 CCGGGCTGAGTGCTGTGGAAGGG 0: 1
1: 0
2: 5
3: 36
4: 532
Right 910408552 1:86915210-86915232 GGCGCTGCCGCCGGAGCAAGTGG 0: 1
1: 0
2: 2
3: 14
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910408552 Original CRISPR GGCGCTGCCGCCGGAGCAAG TGG Intronic
900165413 1:1242503-1242525 GGAGCTGCCGCCGGATCCCGGGG - Exonic
900706357 1:4082585-4082607 GGGACTGCCGCCGGAGTGAGAGG + Intergenic
900792753 1:4690815-4690837 GCCGCTGGTGCCTGAGCAAGGGG + Intronic
901229668 1:7634685-7634707 GGGGCTGCCGGAGGAGGAAGGGG + Intronic
901886894 1:12229929-12229951 GGAGCGGCCGCCGGCGCCAGGGG + Intergenic
902618110 1:17634898-17634920 GGCGCTGCCCCAGGTGCAGGTGG + Exonic
903990322 1:27263196-27263218 GGCCCAGCCGCCGGATAAAGGGG - Exonic
904608889 1:31714614-31714636 GGCGGTGCCGGCGGGGCAAGCGG - Intergenic
904744495 1:32702713-32702735 GGCGCGGGCGCCGGAGCGAGGGG - Exonic
905183325 1:36179419-36179441 GCCGCTGCGGCCCGGGCAAGGGG + Intronic
910237342 1:85048757-85048779 GGAGCTGCCGCCGGCGCCGGGGG + Intronic
910408552 1:86915210-86915232 GGCGCTGCCGCCGGAGCAAGTGG + Intronic
915281634 1:154826573-154826595 GGCGTGGCCGCCAGAGCAGGTGG - Intronic
917817612 1:178725870-178725892 GGCGCAGCCGCCAGGGCCAGGGG - Intronic
920234671 1:204494777-204494799 GGCGCTGCGGCTGGAGCCGGCGG - Intergenic
920529296 1:206690282-206690304 GGCCCTGCTGCAGGAGCCAGGGG - Intronic
922354145 1:224760359-224760381 GGTCCTGCAGCCTGAGCAAGTGG + Intergenic
1063971931 10:11387223-11387245 GGCGCTGGGGCCGGAGGATGAGG + Intergenic
1068461571 10:57336649-57336671 GGTGCTGCTGCTGGCGCAAGTGG + Intergenic
1068498558 10:57816302-57816324 GGGGCTGCAGCCAGAGCAGGCGG - Intergenic
1070562817 10:77580650-77580672 GGCTCTTCTGCAGGAGCAAGAGG - Intronic
1073292745 10:102421417-102421439 CGCGCTGCAGCCGGAGCAGCTGG - Exonic
1075054582 10:119207807-119207829 GCCGCTGCTGCCGGAGCCGGGGG - Exonic
1075885425 10:125896020-125896042 GGCGCGGCTCCCGGAGCAGGAGG + Intronic
1076116950 10:127907396-127907418 GCCGCTGCCGCGGGAGGGAGGGG + Intronic
1076795615 10:132796787-132796809 GACGCTGCCGCCGCACCAGGTGG - Intergenic
1077038675 11:507636-507658 GGCGCGGCCCCCGGAGAAAGCGG + Intergenic
1078527228 11:12110453-12110475 GCCGCTGCCGCCGGCGCACGTGG - Intronic
1083673944 11:64315209-64315231 GGCCCTGCGGCTGGAGCGAGAGG + Exonic
1083886203 11:65574565-65574587 GCCGGAGTCGCCGGAGCAAGGGG + Intergenic
1083901625 11:65646214-65646236 GGCGCTTCCGGAGGAGCTAGGGG - Exonic
1083989828 11:66240165-66240187 GGAGCCGGCGCGGGAGCAAGCGG + Intronic
1086590523 11:88509325-88509347 GGCGCTGGCGCTGGCGCAGGCGG - Exonic
1086914032 11:92507124-92507146 GGTGCTGTCGACAGAGCAAGTGG + Intronic
1090799114 11:130159790-130159812 GGAGCTGCAGCCGGAGAAAGAGG + Exonic
1092997925 12:13967842-13967864 GGCACTGCAGTCAGAGCAAGAGG + Intronic
1096100915 12:48970045-48970067 GGCGCTGCCGCGGAGGCTAGGGG - Intronic
1096157299 12:49347755-49347777 GGCGCTGCCGCCGATGGAAGGGG - Exonic
1102115994 12:110403414-110403436 GGAGCGGCCGCCGGCGCCAGCGG - Intronic
1102521565 12:113480290-113480312 GGCGCCGTCGCCGGAGCAAGGGG + Intergenic
1103534629 12:121626368-121626390 GGCGGTGCCGTCGGAGCGGGCGG + Intergenic
1104682402 12:130760864-130760886 GGGGCTGCCGAGGGAGCAGGAGG - Intergenic
1105240914 13:18609303-18609325 GGCGCTGCGGCCGGAGGAGCTGG + Intergenic
1117913873 14:60657355-60657377 GGCGCGGCCGGAGGAGAAAGAGG + Intronic
1119046062 14:71320275-71320297 GGCCCTGCAGGCGGAGGAAGTGG - Intergenic
1121226255 14:92323734-92323756 GGCGCTGGGGCTGGAGCAGGCGG - Exonic
1127050197 15:55074696-55074718 TGCGCTCCAGCCTGAGCAAGAGG + Intergenic
1133006253 16:2883329-2883351 GGCGCTGTCGCCGGAGAGGGAGG + Exonic
1133033179 16:3021221-3021243 GGAGCTGCCGCGGGAGCAGGGGG - Exonic
1136019338 16:27430092-27430114 GGAGCAGCAGCAGGAGCAAGGGG - Exonic
1137531588 16:49281814-49281836 GGCGCTGCAGCCGGAGCGGGCGG + Exonic
1137665221 16:50245909-50245931 GGCGCTGCCGCGGGAGGGAGCGG - Intergenic
1139496976 16:67326910-67326932 GGCGCTGACGCTGGAGCAGCCGG + Exonic
1141593344 16:85082896-85082918 GGCGGTGACGCCGGGGAAAGCGG + Intronic
1141828710 16:86497865-86497887 GGCTCTGCCGCCGGGTTAAGTGG + Intergenic
1144599763 17:16601340-16601362 GGCGCTGCCTCCAGAGCACCTGG - Intergenic
1144833290 17:18143598-18143620 GGCGCTGCTGTGGGAGCAGGAGG + Exonic
1147967138 17:44199538-44199560 GTCGCCGCCGCCGGAGGACGCGG - Intronic
1149656579 17:58312366-58312388 GGAGCCGCCTCCTGAGCAAGTGG - Exonic
1151565130 17:74893448-74893470 GGCGCTGCTGCGGGAGCTGGAGG - Exonic
1152543994 17:80991821-80991843 GGCGCGGCCGCCGTAGCGGGAGG + Exonic
1153943946 18:10002554-10002576 AGTGCTGCCTCGGGAGCAAGAGG - Intergenic
1154448056 18:14450605-14450627 GGCGCTGCGGCCGGAGGAGCTGG - Intergenic
1155152775 18:23135794-23135816 GGCGCTGCCGCTGCTGCAGGCGG - Exonic
1156331652 18:36129262-36129284 GGCGCTGCCCCCGGACCGAGGGG - Exonic
1157294029 18:46429081-46429103 GGGGCTGCAGCATGAGCAAGCGG - Intronic
1161421791 19:4179926-4179948 GGGGCTGCAGCAGGAGCAGGAGG + Intronic
1162031765 19:7920616-7920638 GGGGCTGCGGCAGGAGCCAGCGG + Intronic
1162480237 19:10923371-10923393 GTCGCTGCCTCCGGAGAACGTGG - Exonic
1165760636 19:38319505-38319527 CGCGCGGCTGACGGAGCAAGGGG - Intergenic
1166091563 19:40512730-40512752 GGCGCTGCTGCAGGAGCTGGAGG + Exonic
1168719887 19:58549151-58549173 GGCGCTGCCGCTGCAGCTACCGG + Exonic
925308798 2:2867434-2867456 GCCCCTGCCCCTGGAGCAAGTGG + Intergenic
925389069 2:3483310-3483332 GGCGCTCCAGCAGGAGCATGAGG + Intronic
927970834 2:27305673-27305695 GGCGCTGGCCCGGGAGCAAGAGG + Exonic
928096071 2:28405779-28405801 GCCTCTGCTGCTGGAGCAAGTGG + Intronic
929590660 2:43143655-43143677 GGCCCTGCCCCAGGAGCAAATGG - Intergenic
929778352 2:44942273-44942295 GGCGGTGCTGGCGGAGCAGGCGG + Exonic
929787028 2:45000683-45000705 GCCGCCCCCGCCGGGGCAAGTGG + Intergenic
935137650 2:100321808-100321830 GGCGCTGCGGCCGGAGGAGCTGG - Exonic
936452360 2:112643254-112643276 CGGGCTGCTGCCGGAGGAAGAGG - Intergenic
937134870 2:119544161-119544183 GGCGGAGCCGCCCGAGCCAGTGG - Intergenic
941909655 2:170751733-170751755 AGCGCTGCCGCCGGGGCCTGGGG + Intergenic
946319631 2:218944526-218944548 GGAGCAGCAGCAGGAGCAAGTGG + Intergenic
948225617 2:236307287-236307309 GGCGCTGTCGTAGGAGCCAGGGG - Intergenic
948402017 2:237691778-237691800 GGAGCTGCGGCCGGAGCCTGAGG + Intronic
1171782321 20:29430609-29430631 GGGGCTGCGGCAAGAGCAAGGGG - Intergenic
1172107971 20:32527971-32527993 GGCCCTGAGGCCGGGGCAAGGGG + Intronic
1172335480 20:34112160-34112182 AGCGCTGCCGCCGGGGCCTGGGG - Exonic
1172497505 20:35398768-35398790 GGCGGTGCAGGGGGAGCAAGAGG + Intronic
1172568974 20:35954218-35954240 GGCGGTGCCACCGGAGAAACTGG - Exonic
1174287765 20:49484188-49484210 GCCGCCGCCGCGGGAGCAGGAGG - Intergenic
1176015241 20:62927499-62927521 GTCCCTGCCCTCGGAGCAAGTGG - Intronic
1176215212 20:63944671-63944693 GGCGCAGCCGCCGTACCAGGCGG + Exonic
1176380501 21:6110359-6110381 GGGGCTGCCCCCGCAGCATGTGG - Intergenic
1176448174 21:6840088-6840110 GGCGCTGCGGCCGGAGGAGCTGG + Intergenic
1176826344 21:13705110-13705132 GGCGCTGCGGCCGGAGGAGCTGG + Intergenic
1179012029 21:37563703-37563725 GGGGCTGCGGCGGGACCAAGCGG + Intergenic
1179150753 21:38806228-38806250 GGCGCTGCCGGGGGTGCAGGTGG + Intronic
1179561609 21:42219279-42219301 GGCGGTGCCGACCGAGAAAGCGG - Exonic
1179742971 21:43427881-43427903 GGGGCTGCCCCCGCAGCATGTGG + Intergenic
1179808063 21:43852583-43852605 GGGGCTGCGGACGGAGCCAGAGG + Intergenic
1180951862 22:19724047-19724069 GGCGCTGCCGCCGGGGCTGCTGG + Exonic
1180965260 22:19784804-19784826 GCCGCTGCCTCCGGTGCAGGTGG - Exonic
1181472745 22:23150947-23150969 GGAGCTGCCGCGGCAGGAAGAGG - Intronic
1182321463 22:29480652-29480674 GGCGCTGCGGCAGCAGCAGGCGG + Exonic
1183540751 22:38428081-38428103 GGCGCTTCCGCCGGGGCACGTGG + Exonic
951217744 3:20040546-20040568 GGCGCTGCCCCCGCAGCCTGCGG + Exonic
952039171 3:29241065-29241087 GGTGCTGGGGCCGGGGCAAGCGG + Intergenic
954553140 3:51499112-51499134 AGCGCTGCCACCGCAGTAAGAGG + Intronic
957083170 3:75655773-75655795 GGGGCTGCCGCAAGAGCAAGGGG + Intergenic
957792481 3:84959030-84959052 GCCGCTGCAGCCGGAGCATCCGG + Intronic
961934725 3:130571124-130571146 GGGGCAGCCGCCTGAACAAGGGG + Exonic
962809034 3:138946270-138946292 GGCGCCGCCGCCGCATGAAGAGG - Exonic
965571961 3:170181783-170181805 GGCTCAGCCCCCGGAGCCAGAGG + Intergenic
967055511 3:185825662-185825684 TGCGCTGCTGCCAGGGCAAGCGG + Intergenic
968286196 3:197510249-197510271 CGCGCTGCCGCCCGAGCCTGAGG - Exonic
968915049 4:3493653-3493675 GTGGCTGCCACCGGAGGAAGGGG + Exonic
969256910 4:6008404-6008426 AGCGCTGCCGGCGGACCCAGCGG - Intergenic
982798638 4:159674430-159674452 GGTGCAGAAGCCGGAGCAAGCGG - Intergenic
984721014 4:182973135-182973157 GCCGAGGCCGCCGGATCAAGAGG + Intergenic
997129667 5:131264127-131264149 GGGGCTGCGGCCGGAGCGGGCGG + Exonic
1001576944 5:172770889-172770911 GGCGCTGCTGGGGGAGCGAGCGG - Exonic
1003293810 6:4805995-4806017 GCCGCTGGCGCAGGAGCATGAGG + Intronic
1006361741 6:33590690-33590712 GGCGCTGTCCCTGGAGCAGGAGG + Intergenic
1007625368 6:43243571-43243593 GCCGCCGCCGCCGGAGGGAGCGG + Intergenic
1029167009 7:98599503-98599525 GGCCCTGCCCCTGGAGCATGTGG + Intergenic
1034183813 7:149159012-149159034 TGCACTGCAGCCTGAGCAAGAGG - Intronic
1049109939 8:140636011-140636033 GGCTGTGCCGCCGGAGCCGGAGG + Intergenic
1049338906 8:142101427-142101449 GGCGCTGCCTTCCGAGCCAGGGG - Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049738608 8:144223209-144223231 CGCGCTGCCCCCCGAGCAGGAGG + Exonic
1049748145 8:144271669-144271691 GGCCCTGGCGCCGGGGCCAGAGG + Intronic
1057311485 9:93945905-93945927 GGCGGCGCCGCCCGTGCAAGGGG - Intergenic
1057361170 9:94374828-94374850 GGAGCCGCCGCCGGAGCTGGAGG + Exonic
1057662193 9:97013336-97013358 GGAGCCGCCGCCGGAGCTGGAGG - Exonic
1057741075 9:97711560-97711582 GGCGCTGCCGCCAGAGGAGGGGG + Intergenic
1060255977 9:122031419-122031441 GGAGCTGGAGCCGGAGCAGGTGG - Intronic
1062160180 9:135075615-135075637 GGCGCCGCCGCCGGAGCCAGCGG + Intronic
1203521017 Un_GL000213v1:44430-44452 GGCGCTGCGGCCGGAGGAGCTGG - Intergenic