ID: 910414270 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:86981672-86981694 |
Sequence | GGGATAGGCTCCCACGGCCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 1620 | |||
Summary | {0: 1, 1: 2, 2: 59, 3: 395, 4: 1163} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
910414262_910414270 | 27 | Left | 910414262 | 1:86981622-86981644 | CCAAAATCTCATTTGATTCCATG | 0: 1 1: 6 2: 27 3: 79 4: 355 |
||
Right | 910414270 | 1:86981672-86981694 | GGGATAGGCTCCCACGGCCTTGG | 0: 1 1: 2 2: 59 3: 395 4: 1163 |
||||
910414264_910414270 | 9 | Left | 910414264 | 1:86981640-86981662 | CCATGTCTCACATCCAGGACACA | 0: 20 1: 575 2: 1133 3: 1681 4: 1777 |
||
Right | 910414270 | 1:86981672-86981694 | GGGATAGGCTCCCACGGCCTTGG | 0: 1 1: 2 2: 59 3: 395 4: 1163 |
||||
910414267_910414270 | -4 | Left | 910414267 | 1:86981653-86981675 | CCAGGACACACTGATGCAAGGGA | 0: 1 1: 21 2: 171 3: 829 4: 1516 |
||
Right | 910414270 | 1:86981672-86981694 | GGGATAGGCTCCCACGGCCTTGG | 0: 1 1: 2 2: 59 3: 395 4: 1163 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
910414270 | Original CRISPR | GGGATAGGCTCCCACGGCCT TGG | Intronic | ||