ID: 910414270

View in Genome Browser
Species Human (GRCh38)
Location 1:86981672-86981694
Sequence GGGATAGGCTCCCACGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1620
Summary {0: 1, 1: 2, 2: 59, 3: 395, 4: 1163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910414262_910414270 27 Left 910414262 1:86981622-86981644 CCAAAATCTCATTTGATTCCATG 0: 1
1: 6
2: 27
3: 79
4: 355
Right 910414270 1:86981672-86981694 GGGATAGGCTCCCACGGCCTTGG 0: 1
1: 2
2: 59
3: 395
4: 1163
910414264_910414270 9 Left 910414264 1:86981640-86981662 CCATGTCTCACATCCAGGACACA 0: 20
1: 575
2: 1133
3: 1681
4: 1777
Right 910414270 1:86981672-86981694 GGGATAGGCTCCCACGGCCTTGG 0: 1
1: 2
2: 59
3: 395
4: 1163
910414267_910414270 -4 Left 910414267 1:86981653-86981675 CCAGGACACACTGATGCAAGGGA 0: 1
1: 21
2: 171
3: 829
4: 1516
Right 910414270 1:86981672-86981694 GGGATAGGCTCCCACGGCCTTGG 0: 1
1: 2
2: 59
3: 395
4: 1163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910414270 Original CRISPR GGGATAGGCTCCCACGGCCT TGG Intronic