ID: 910418519

View in Genome Browser
Species Human (GRCh38)
Location 1:87028678-87028700
Sequence TTTTGCAAACTCTAAATTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910418517_910418519 8 Left 910418517 1:87028647-87028669 CCATATGTTAGATACATGTATAC No data
Right 910418519 1:87028678-87028700 TTTTGCAAACTCTAAATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910418519 Original CRISPR TTTTGCAAACTCTAAATTTT GGG Intronic
No off target data available for this crispr