ID: 910422437

View in Genome Browser
Species Human (GRCh38)
Location 1:87080768-87080790
Sequence GGGGAGAGCACAGTGATTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910422425_910422437 26 Left 910422425 1:87080719-87080741 CCCTGGTAGCTGCCACATGGCGC No data
Right 910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG No data
910422426_910422437 25 Left 910422426 1:87080720-87080742 CCTGGTAGCTGCCACATGGCGCA No data
Right 910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG No data
910422427_910422437 14 Left 910422427 1:87080731-87080753 CCACATGGCGCAGAAAGAGAATC 0: 1
1: 2
2: 19
3: 50
4: 174
Right 910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG No data
910422424_910422437 27 Left 910422424 1:87080718-87080740 CCCCTGGTAGCTGCCACATGGCG No data
Right 910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG No data
910422423_910422437 28 Left 910422423 1:87080717-87080739 CCCCCTGGTAGCTGCCACATGGC No data
Right 910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910422437 Original CRISPR GGGGAGAGCACAGTGATTGC GGG Intronic
No off target data available for this crispr