ID: 910424283

View in Genome Browser
Species Human (GRCh38)
Location 1:87103274-87103296
Sequence GAAACAGGTGTGCCTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910424283 Original CRISPR GAAACAGGTGTGCCTCCCAC AGG Intronic
900008257 1:79800-79822 GAAACACGTCTGTCTCCCATGGG + Intergenic
901313093 1:8284769-8284791 GAGACAGGTGTGGCTCTCCCTGG - Intergenic
902271644 1:15309251-15309273 GAAACAGCTGTGCCTGGCAAGGG - Intronic
902369761 1:15998551-15998573 GAAACAGCTGTGCATCTCCCAGG + Intergenic
905632542 1:39526700-39526722 GAAAGAGGTATGACTCCCACAGG + Intergenic
910424283 1:87103274-87103296 GAAACAGGTGTGCCTCCCACAGG + Intronic
917919664 1:179740754-179740776 GAAACAGGTGTGGCTACGAAAGG + Intergenic
919574874 1:199295213-199295235 CAAACAGGTGTGCCTTCAACTGG - Intergenic
923013804 1:230110053-230110075 AGAGCAGGTGTGCCTCCCACAGG + Intronic
1062923541 10:1297724-1297746 GAAAAAGGTGTGCCCCCCGGTGG - Intronic
1063143173 10:3274037-3274059 GATACAGGTGTCCCTTCCAGGGG - Intergenic
1072631399 10:97149269-97149291 GAAAGAGGCGAGCGTCCCACTGG - Intronic
1073094457 10:100971308-100971330 TAAACAGGTGTGCCTCCACAGGG + Intronic
1076450644 10:130554784-130554806 GAGACAGATGTGCCCACCACTGG - Intergenic
1084223102 11:67696922-67696944 GAAACAGCCCTTCCTCCCACAGG - Intergenic
1084486189 11:69449687-69449709 GCAGCAGGTGTGCATCCCAGGGG + Intergenic
1084614992 11:70229847-70229869 GAATCAGAGGTGCCTCCCAGAGG + Intergenic
1087234841 11:95706515-95706537 TAAACAGGTTTCCCTCCCTCTGG + Intergenic
1088660895 11:112045144-112045166 GCAGCTGTTGTGCCTCCCACAGG + Exonic
1092159841 12:6310353-6310375 GAGAGAGGGGTGCCTGCCACAGG + Intergenic
1093207792 12:16271156-16271178 GAAACAGAGGGGACTCCCACTGG - Intronic
1095390526 12:41700800-41700822 GAAACAGGTCTACCTTACACTGG - Intergenic
1095687192 12:45050335-45050357 GAAAGTGGTGTGCCTCCGCCTGG + Intronic
1101825712 12:108218589-108218611 GATGCATGTGTGCCACCCACAGG + Intronic
1106182390 13:27380753-27380775 GACACAGGTCTCCCTCCCAGGGG - Intergenic
1106549697 13:30760534-30760556 GAAACAGCTGTGCCCTCCACAGG - Intronic
1106911541 13:34468343-34468365 GAAACAGGTTTGCCCCACTCTGG + Intergenic
1108267974 13:48731151-48731173 GAGACCTGTGTGTCTCCCACAGG - Intergenic
1112264554 13:97911403-97911425 GAAACAGCAGTGACTCACACAGG + Intergenic
1113851293 13:113419961-113419983 TAAGCAGGTGTGTCTCACACAGG + Intergenic
1118744081 14:68761580-68761602 AAACCAGATGTGCCTGCCACAGG + Intergenic
1118869019 14:69726318-69726340 GGAAGTGGTGTGTCTCCCACAGG + Intergenic
1121262920 14:92579694-92579716 GAAACATGTGTGCCTGGCACTGG + Intronic
1122023577 14:98858893-98858915 TCACCAGGTGAGCCTCCCACGGG + Intergenic
1122441358 14:101734448-101734470 GACACAGCTGTGCCCTCCACAGG + Intergenic
1123125332 14:105941866-105941888 GACAAAGGTGTGCGTCCCATGGG + Intergenic
1125748908 15:42015392-42015414 GAAACGGGAGCGGCTCCCACAGG - Intronic
1132445298 15:101912310-101912332 GAAACAAGTCTGTCTCCCATGGG - Intergenic
1132565029 16:618138-618160 GAAGGAGGTGAGCCTCTCACAGG + Intronic
1140477860 16:75247976-75247998 GAAAGAGCTCTGCCTCCCGCAGG - Intronic
1141386987 16:83630860-83630882 GGAGCAGGTTTGCCTCCCATAGG + Intronic
1142191685 16:88721051-88721073 GATCCAGGTGGGCCTCGCACTGG + Intronic
1143163562 17:4886425-4886447 GAAACAGTGGTGGCTCACACTGG - Intronic
1148847645 17:50538618-50538640 GAAGCAGCTGGGCCTCACACAGG + Intronic
1148956279 17:51356187-51356209 GGAACAGCTCTGCCTCCCTCAGG + Intergenic
1150833191 17:68541610-68541632 GAACCAGGTGTCCCTCCCATGGG + Intronic
1151983906 17:77529726-77529748 GAACCAGGTGTCCTTCCCGCAGG + Intergenic
1153225365 18:2895730-2895752 GAAGCTGCTGGGCCTCCCACAGG + Intronic
1154001814 18:10487956-10487978 GGACCAGGTGTGCCTCCCAGGGG - Exonic
1155239552 18:23852567-23852589 CAAACATGTGTGCCTTCCACAGG - Intronic
1156872483 18:41962592-41962614 GAAACCGTTGTTCCTCCTACAGG - Exonic
1157483227 18:48069219-48069241 GTAACAGGCGTGCCACCCACAGG - Intronic
1157910132 18:51609638-51609660 GAAGCAGGGGTGCATCCCATGGG + Intergenic
1158326015 18:56314632-56314654 GAAACACGAGTGGCTCCCCCTGG + Intergenic
1160640011 19:121397-121419 GAAACAAGTCTGTCTCCCATGGG + Intergenic
1165704371 19:37965260-37965282 GAAATATGTTTGCTTCCCACAGG + Intronic
1166691640 19:44825024-44825046 TACACAGGTGTCCCTCTCACAGG + Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
926150275 2:10422020-10422042 CAAATAGGTGTGCCTGTCACTGG + Intronic
927237336 2:20886123-20886145 GAAATAGGTGTGCTGCCCTCAGG - Intergenic
928403955 2:30999965-30999987 AAAACATGTGTGGCTCCAACCGG - Intronic
930086907 2:47504138-47504160 GAAGCAAGTGAGCCTCCCACAGG - Intronic
933793456 2:85902090-85902112 GAAAAATGTGTGCCTACCACTGG - Intergenic
934983824 2:98869731-98869753 GAGACGAGCGTGCCTCCCACAGG - Intronic
935595459 2:104874001-104874023 GAAGCAGGTGCGCCTGCCTCGGG - Intergenic
937663583 2:124459338-124459360 GAAACATGGTGGCCTCCCACAGG - Intronic
938381319 2:130837822-130837844 CACACAGGTCTGCCTCCCCCTGG - Intronic
940616932 2:156060333-156060355 GAATCAGGTGTGGCTCCCCATGG + Intergenic
1172274771 20:33673638-33673660 GAGACAGCTTTGCCTCCCTCTGG + Intronic
1172551174 20:35801334-35801356 AACACAGGTGTGTCTTCCACTGG - Intronic
1172808358 20:37629508-37629530 GGGACAGGTGTGCCTGCCAGTGG + Intergenic
1179441210 21:41395518-41395540 CAAACAGGTTTGACTCCTACTGG - Intronic
1183330487 22:37218237-37218259 GAAACAGGAGTGGCTAACACAGG - Intergenic
1185102339 22:48848078-48848100 CCCACAGGTGTGCCTCCCACAGG - Intronic
950645273 3:14373340-14373362 GCCAGAGGTGTGCCGCCCACGGG + Intergenic
952493844 3:33898782-33898804 GAAAGGGGTGCGCCTCTCACTGG + Intergenic
952954732 3:38549832-38549854 GAATCCAGTGTGGCTCCCACAGG - Exonic
953849594 3:46455609-46455631 GACTCAGCTGTGCCTCCCAAGGG + Intronic
954901748 3:54026017-54026039 GAACCAAGTGTGCAACCCACAGG - Intergenic
960531170 3:118766690-118766712 GATACATGTGTGCCTGGCACTGG + Intergenic
965538474 3:169849417-169849439 GAAACAGCTGTGCCTTCTAATGG + Intronic
965791089 3:172388607-172388629 CATACAGCTGTGCCTCCCCCAGG - Intronic
967540028 3:190656448-190656470 TACAGAGGTGTGTCTCCCACTGG - Exonic
968950817 4:3690478-3690500 GAAGCAGGTGAGCCTCCTGCAGG + Intergenic
970060226 4:12025307-12025329 TATACAGGTCTCCCTCCCACAGG + Intergenic
978940924 4:114435072-114435094 CCAACAGGAGTGCCTCCCAGGGG - Intergenic
981799137 4:148635756-148635778 GTAGCAGTTGTCCCTCCCACAGG + Intergenic
986003490 5:3648759-3648781 GAAACAGGTGAGATGCCCACAGG + Intergenic
988511284 5:31866663-31866685 GAAACAGGTGCCTCTCCCACAGG - Intronic
988511747 5:31870070-31870092 GAAACAGGTGCCTCTCCCACAGG - Intronic
993184180 5:84595169-84595191 GAATCAGTTGTTGCTCCCACTGG + Intergenic
997416387 5:133732040-133732062 GCAACCTGTGTGCTTCCCACCGG + Intergenic
1002747361 6:69804-69826 GAAACAAGTCTGTCTCCCATGGG + Intergenic
1005021618 6:21423868-21423890 GAAAGGGGTGGGGCTCCCACCGG + Intergenic
1007124530 6:39414482-39414504 GAAAAAGGTGTGCCTTCCTATGG + Intronic
1012472430 6:99587505-99587527 GAAAAAAGTATGCCTCCCAGAGG + Intergenic
1015571720 6:134628442-134628464 GAAACAAGTGTACCAGCCACCGG - Intergenic
1018102381 6:160452604-160452626 TAAACATGTGTCTCTCCCACAGG + Intergenic
1019576007 7:1737959-1737981 GGGACAGCTCTGCCTCCCACAGG - Intronic
1019786149 7:2978756-2978778 GAAACAGGTGAGCCGGCCTCCGG - Intronic
1028337083 7:89671269-89671291 GAAACAGGCTTGCATCCCAGGGG + Intergenic
1030234378 7:107242677-107242699 GAAACCAGTCTGTCTCCCACAGG + Intronic
1030812414 7:113990085-113990107 TGAACAGGTGTGGCTCCTACAGG - Intronic
1032639173 7:133746554-133746576 GAAACACGTATTCCTCTCACTGG - Intronic
1039404594 8:37301665-37301687 GATCCATGTGTGCCTCCCACTGG - Intergenic
1039953654 8:42191136-42191158 GAAACAGGTGTTCCCCCCCAAGG - Intronic
1041357219 8:57013867-57013889 GGAACAGCTCAGCCTCCCACAGG + Intergenic
1046048363 8:108989461-108989483 GAATCAGGTGTTTCTGCCACAGG - Intergenic
1047033238 8:120906763-120906785 GCCACAAGTGTGCATCCCACAGG - Intergenic
1047339533 8:123967355-123967377 GAATGAGCTGTACCTCCCACAGG - Intronic
1047858650 8:128939991-128940013 GAAACAGATGTGCCTTCAAAGGG - Intergenic
1048356525 8:133658260-133658282 GGATCAGGTGAACCTCCCACAGG - Intergenic
1048823018 8:138397029-138397051 GAGCCAGGTGTGCATCCCTCAGG + Intronic
1049598821 8:143497850-143497872 GAACACGCTGTGCCTCCCACAGG + Intronic
1052113302 9:24617031-24617053 GATATAGCGGTGCCTCCCACAGG + Intergenic
1053289989 9:36873494-36873516 GCAACAGGTGTGCACCCCAGAGG + Intronic
1055540086 9:77294388-77294410 GAGATAGGTGTGACACCCACAGG - Intronic
1057159340 9:92875679-92875701 GAAACAGGTGTGCCTAGGATTGG - Intronic
1057242037 9:93419888-93419910 CAGACAGGTGTGACTCTCACTGG + Intergenic
1061856147 9:133442971-133442993 GCAGCAGGTGTGGGTCCCACTGG - Intronic
1062423939 9:136497540-136497562 GAAACAGGGGTGTCTCCTCCTGG + Exonic
1187194660 X:17071656-17071678 GAAACGCTTGTGTCTCCCACTGG - Intronic
1198315506 X:135461899-135461921 GAAACAGATTTACCTCTCACAGG + Intergenic