ID: 910427310

View in Genome Browser
Species Human (GRCh38)
Location 1:87130488-87130510
Sequence CAGACAGGTGGCCTGTCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910427303_910427310 10 Left 910427303 1:87130455-87130477 CCAGATCAGGGCACAGTACCACT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 910427310 1:87130488-87130510 CAGACAGGTGGCCTGTCGTGTGG No data
910427304_910427310 -8 Left 910427304 1:87130473-87130495 CCACTCCCTTGCTGCCAGACAGG 0: 1
1: 0
2: 3
3: 24
4: 341
Right 910427310 1:87130488-87130510 CAGACAGGTGGCCTGTCGTGTGG No data
910427301_910427310 20 Left 910427301 1:87130445-87130467 CCTAAGCCTTCCAGATCAGGGCA 0: 1
1: 0
2: 1
3: 21
4: 194
Right 910427310 1:87130488-87130510 CAGACAGGTGGCCTGTCGTGTGG No data
910427302_910427310 14 Left 910427302 1:87130451-87130473 CCTTCCAGATCAGGGCACAGTAC 0: 1
1: 0
2: 1
3: 12
4: 156
Right 910427310 1:87130488-87130510 CAGACAGGTGGCCTGTCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910427310 Original CRISPR CAGACAGGTGGCCTGTCGTG TGG Intronic
No off target data available for this crispr