ID: 910427526

View in Genome Browser
Species Human (GRCh38)
Location 1:87131940-87131962
Sequence GCCCGAGGCGCGGTCGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910427518_910427526 15 Left 910427518 1:87131902-87131924 CCTCCGACACTAGGTGGCGCCAT 0: 1
1: 0
2: 0
3: 0
4: 41
Right 910427526 1:87131940-87131962 GCCCGAGGCGCGGTCGCAGCCGG 0: 1
1: 0
2: 0
3: 16
4: 128
910427519_910427526 12 Left 910427519 1:87131905-87131927 CCGACACTAGGTGGCGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 910427526 1:87131940-87131962 GCCCGAGGCGCGGTCGCAGCCGG 0: 1
1: 0
2: 0
3: 16
4: 128
910427522_910427526 -4 Left 910427522 1:87131921-87131943 CCATAGGAACATCCTCGCGGCCC 0: 1
1: 0
2: 0
3: 2
4: 42
Right 910427526 1:87131940-87131962 GCCCGAGGCGCGGTCGCAGCCGG 0: 1
1: 0
2: 0
3: 16
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910427526 Original CRISPR GCCCGAGGCGCGGTCGCAGC CGG Intronic
900671299 1:3856808-3856830 GCGCGGGGCGCGGGCGCCGCGGG - Intronic
900787160 1:4656025-4656047 GCCCGACGGGCGCTCACAGCTGG + Intronic
905183147 1:36178715-36178737 GGCCGAGGCCCGGGCGGAGCGGG + Exonic
905308405 1:37034129-37034151 GCCCGGGGCGCGGCCGTGGCGGG + Intronic
905862719 1:41361774-41361796 GGCCGAGGCGCGGAGGCAGGGGG - Intergenic
906090292 1:43172670-43172692 GCCGGGGGCGGGGTCGGAGCGGG + Intronic
906214245 1:44030120-44030142 GCCCGAGGCGCGGAGGCCTCCGG + Intronic
910427526 1:87131940-87131962 GCCCGAGGCGCGGTCGCAGCCGG + Intronic
910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG + Intronic
913600179 1:120414998-120415020 GCCCAAGGCGCAGGCGCAGCGGG - Intergenic
914086881 1:144461666-144461688 GCCCAAGGCGCAGGCGCAGCGGG + Intronic
914311730 1:146472547-146472569 GCCCAAGGCGCAGGCGCAGCGGG - Intergenic
914361332 1:146938701-146938723 GCCCAAGGCACAGGCGCAGCTGG - Intergenic
914491278 1:148152009-148152031 GCCCAAGGCACAGGCGCAGCTGG + Exonic
914590685 1:149103558-149103580 GCCCAAGGCGCAGGCGCAGCGGG + Intronic
917962222 1:180154551-180154573 GCCCGCCGAGCGGTCGCTGCGGG - Intergenic
921604353 1:217137469-217137491 GCCCCAGGCGCGGTCTTCGCGGG - Intronic
923490263 1:234478351-234478373 GCCGCGGGCGCGGTCGCCGCCGG + Exonic
1070577507 10:77690496-77690518 GCCTGAGGCGGGATGGCAGCAGG + Intergenic
1070610230 10:77927237-77927259 CCCCGAGGCCCAGGCGCAGCCGG + Intergenic
1072503852 10:96044319-96044341 ACCCCAGGCGCGGTCACTGCCGG - Intronic
1077130367 11:969025-969047 GCCAGAGCGGCTGTCGCAGCTGG + Intronic
1077491405 11:2862554-2862576 GCGCGAGGAGCGGGCGCGGCCGG - Intergenic
1080779558 11:35418557-35418579 GCCCGAGGCGGGCTTGCAGGTGG - Intronic
1083613734 11:64016383-64016405 GGCAGAGGGGCGGGCGCAGCTGG - Intronic
1083845931 11:65333670-65333692 GCCCGACGCGCAGGCGCAACCGG - Intergenic
1084979591 11:72822077-72822099 GCGAGAGGCGCGGGCGCAGCAGG + Exonic
1086349846 11:85934725-85934747 GCTCGAGGCGCGGACGCGGGCGG - Intergenic
1091550105 12:1530462-1530484 GCCCGAGGCGCGGGCTCGGGAGG - Intronic
1092207007 12:6620852-6620874 GCAGGTGGCGCAGTCGCAGCGGG + Exonic
1096309176 12:50505191-50505213 GCCTGAAGTGCGGGCGCAGCTGG + Exonic
1096389452 12:51217652-51217674 GCCCGAGCCGCCTTCGCCGCGGG + Exonic
1102394704 12:112575711-112575733 GCCTGATGCGGGGTCCCAGCCGG - Intronic
1103534760 12:121626825-121626847 GCCGGAGCCGCCGCCGCAGCGGG + Exonic
1103764743 12:123271917-123271939 GCGCGGGGCGCGGCCGCAGGCGG - Exonic
1104001637 12:124863976-124863998 GCCCGGGGCGGGGTCGGGGCGGG + Intronic
1106107189 13:26742976-26742998 GCCCGAGGCGAGGATGCCGCCGG - Intergenic
1113378598 13:109784683-109784705 GCCCGAGCCGTGGCCGCTGCTGG + Exonic
1119438218 14:74611674-74611696 GCCCGTGGAGCGGGCCCAGCCGG - Exonic
1120780157 14:88479576-88479598 GCCCGTGGCGCACTCGCTGCAGG - Exonic
1121098572 14:91234262-91234284 GCCCTTGGCGAAGTCGCAGCTGG + Exonic
1121417172 14:93787724-93787746 GCCCCAGGAGCGGGCGCCGCTGG - Exonic
1124001857 15:25766742-25766764 GCCCGAGGAGCGCTTGCAGGCGG - Intronic
1125500842 15:40239567-40239589 GCCCGGGGGGCTGTGGCAGCAGG + Exonic
1125589225 15:40844210-40844232 GGCCGAGGCGCAGGCGGAGCGGG + Intronic
1128119182 15:65133394-65133416 GCCTGAGGCGCCGCCGCCGCCGG - Exonic
1131180170 15:90233975-90233997 GCCCCAGGAGCGGTTGCCGCGGG - Exonic
1132149069 15:99447081-99447103 GCCCCAGGCGCGCAGGCAGCGGG - Intergenic
1133097683 16:3458315-3458337 GCCGGGGGCGCGGGCGCGGCCGG - Intronic
1133784300 16:8963179-8963201 GCCCGAGGGCCGGCCGCGGCGGG - Intronic
1134069969 16:11254965-11254987 GCACGCGGCGCTGGCGCAGCGGG + Exonic
1134539935 16:15056037-15056059 GCCCGAGGGGCGGGGGCGGCGGG - Exonic
1139402955 16:66696681-66696703 GACCGAGCCGCAGCCGCAGCCGG - Exonic
1140481677 16:75265758-75265780 GGGCGGGGCGAGGTCGCAGCCGG + Intronic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1142590995 17:1006058-1006080 GCCCGAGGCAGGGTGGCTGCGGG - Exonic
1143747274 17:9003595-9003617 GCCCGGGGCGCGGGCGCGGCAGG - Intergenic
1147672414 17:42184271-42184293 GCCCGCGGCGTGGTTGCCGCTGG + Exonic
1150643775 17:66965725-66965747 GGCGGGGGCGCGGTCGGAGCCGG + Intronic
1152220654 17:79063396-79063418 TCCCGAGGCCCGGTCCCAGTAGG - Intergenic
1152467800 17:80475782-80475804 GCCCGCGGCGCGGTCCCCTCTGG + Intronic
1154940789 18:21111368-21111390 GCCCGAGCGGCGGCCGCAGCTGG - Exonic
1155507828 18:26549169-26549191 GCCCGCGGCCAGGGCGCAGCGGG + Exonic
1159947819 18:74457197-74457219 GCAGGAGGCGCGGGCGCTGCGGG - Exonic
1160204772 18:76823084-76823106 GCCCGGGGCGCGGTATCCGCAGG - Intronic
1160499969 18:79396591-79396613 GCGCGAGGCGAGGCCGCCGCGGG + Intronic
1160699158 19:497811-497833 GCGAGAGCCGCGGTCGCCGCAGG + Exonic
1160868597 19:1266907-1266929 GGCCGAGGCGCGGGGGCGGCGGG + Intronic
1162802314 19:13118353-13118375 GGCCGAGGCCCCGGCGCAGCGGG + Exonic
1163708654 19:18832494-18832516 GCCCGAGGCGAGTTCGGGGCAGG - Intronic
1165213666 19:34254522-34254544 GCCCGAGGCGGGGGCGGGGCCGG + Exonic
1165408249 19:35643403-35643425 GCCCGCGGCGCCTTCGGAGCCGG - Exonic
1165420906 19:35721409-35721431 GCCCGAGGCTCAGGCTCAGCTGG - Exonic
1166502811 19:43353940-43353962 CCCCAAGCCGCTGTCGCAGCTGG - Exonic
1166536230 19:43576634-43576656 GCCCTGGGTGGGGTCGCAGCTGG + Intronic
1167077042 19:47256574-47256596 GCCGGAGTCGCGGACGCCGCGGG + Exonic
1167369591 19:49072639-49072661 GGCCGAGGCGGGGCCGCACCGGG - Exonic
1168098674 19:54129315-54129337 GCCCGAGGAGCGGTCGCGGATGG - Exonic
929946541 2:46376692-46376714 GCCCGAGGAGCTGGCCCAGCTGG + Exonic
935046599 2:99489412-99489434 GGCCGAGGCGCCGGCGCAGGAGG + Intronic
938397840 2:130963926-130963948 GCCCGGGCCGGGGTCGCAGTCGG - Intronic
1168830130 20:841294-841316 GCCAGCGGCGCGGGCGCAGCCGG + Intronic
1169914258 20:10671809-10671831 GCTCGAGGCCCGGGCCCAGCTGG - Intronic
1173576640 20:44116293-44116315 GACCGGGGCGCCGGCGCAGCGGG - Exonic
1174380740 20:50153856-50153878 GCCGGAGGCTGGGACGCAGCTGG + Intergenic
1175964036 20:62651375-62651397 GCCCGAAGCCAGGTCGCTGCTGG + Intronic
1176005645 20:62861127-62861149 GCCCGAGGCCCGGGCCAAGCCGG - Exonic
1178610113 21:34073094-34073116 GCGCAAGGCGGGGTCGCGGCCGG - Intergenic
1180002398 21:45001314-45001336 GCCCGGGGCCTGGTAGCAGCAGG + Intergenic
1180866313 22:19122018-19122040 GCCCCAGGCGCGGCCCCTGCAGG + Intronic
1181064506 22:20299211-20299233 TCCCGAGGAGCGGGCGCGGCTGG + Intergenic
1182771776 22:32801644-32801666 GCCCGAGGCGGGGTCCCCGGGGG + Intronic
1184155078 22:42662181-42662203 GCCCGGGGCGCGGGTCCAGCCGG + Intergenic
1184265290 22:43343103-43343125 GGCCGAGGCGCGGTCCCGGAGGG - Intronic
1185395018 22:50582446-50582468 GCCCCAGGCGCGGGCGCAAGAGG + Intronic
950487868 3:13283296-13283318 GACCCAGGGGCGGTCCCAGCAGG - Intergenic
952241295 3:31533172-31533194 GTCCGGGGGGCTGTCGCAGCCGG + Exonic
953326240 3:42014138-42014160 GCCCGAGGCGCAGGCGGCGCGGG - Intronic
954662082 3:52231660-52231682 GCCCGGGGCCAGGACGCAGCAGG + Intronic
956681466 3:71785323-71785345 GCCCGAGGCGGGGGCGCGGGGGG - Intergenic
963035163 3:141019499-141019521 GCCCGGGCCGCGGGCGCAGCTGG - Intergenic
967849453 3:194071085-194071107 GCCCGGGGCCGGGTGGCAGCGGG + Intergenic
967930450 3:194686862-194686884 GGCCGAGGCGCCGCCGCGGCAGG + Exonic
968422762 4:499264-499286 GCCGGAAGCGCGGCTGCAGCAGG + Exonic
968756501 4:2418761-2418783 GCCCGAGGCGCGCTCCCTGCCGG + Intergenic
976269805 4:83219510-83219532 GCCCGTGGCACAGTCCCAGCTGG + Intergenic
976398579 4:84583173-84583195 GCCGGAGCCGCGCTCGCTGCAGG + Exonic
976704800 4:88008396-88008418 GCCCGGGGAGCTGCCGCAGCGGG - Intronic
978361163 4:107932051-107932073 GCGCGAGGCGCTGGTGCAGCAGG + Exonic
985705941 5:1401463-1401485 GCCCCAGGAGCTGCCGCAGCGGG - Intronic
987073475 5:14359432-14359454 GGACGAGGCGCAGTCGCAGATGG + Exonic
992102350 5:73419664-73419686 GCAGGAGGCGCGGCCGCAGCCGG + Intergenic
992527910 5:77629990-77630012 GACCGAGCCGAGGGCGCAGCTGG + Exonic
994197270 5:96935219-96935241 GCCCGGGTCGCGGGCGCCGCAGG - Intronic
997013426 5:129904716-129904738 CCCCCAGCCGCGGCCGCAGCCGG - Exonic
1001159499 5:169300853-169300875 GCACGGGGCGCGGGCGGAGCGGG + Intronic
1002277451 5:178113410-178113432 GCCGGGGGCGCGGTCGGGGCCGG + Intergenic
1002291678 5:178204786-178204808 GCCTGACGCGCTGTCGCCGCTGG + Intronic
1002600660 5:180352687-180352709 GCCTGAGGCACTGACGCAGCGGG + Intronic
1004615077 6:17281532-17281554 GCCCGAGCCGCAGCCGCAGCCGG + Exonic
1007630312 6:43269755-43269777 GCCCGAGGAGCCGCCGCCGCCGG - Intronic
1007785295 6:44276283-44276305 GCCTGTGGCGCAGCCGCAGCGGG + Exonic
1010204479 6:73310143-73310165 GCCCGAGGCACTGTAGCAGGAGG + Exonic
1018390044 6:163335269-163335291 GGCCAAGGTGCAGTCGCAGCTGG - Intergenic
1022089159 7:27096508-27096530 ACCCGGGGCGCGGTGTCAGCCGG - Intergenic
1023000314 7:35801414-35801436 GCCCGGGGCGCGGCAGCGGCGGG + Intronic
1023989073 7:45117416-45117438 GCCCGGGGCTCTGTCCCAGCTGG + Intergenic
1029440030 7:100582409-100582431 GCCCGAGGCGGCGTGCCAGCTGG - Exonic
1031997243 7:128240926-128240948 GCGCGGGGCGCGGTCGGGGCGGG - Intergenic
1033365953 7:140672914-140672936 GCCCAGGGCGCGGGCGCAGGCGG - Intronic
1034446080 7:151115004-151115026 GGCCGAGGCGCGGGCGCAGGAGG - Intronic
1034977058 7:155454927-155454949 GCGCGAGGCGCCGTCCCAGCTGG + Intergenic
1036482483 8:9151076-9151098 TCCCGGGTCACGGTCGCAGCCGG + Intronic
1040055900 8:43056555-43056577 TCCCGAGCCGCGGCCGCCGCGGG - Intronic
1048833373 8:138497058-138497080 CCCAGCGGCGCGGGCGCAGCCGG - Intergenic
1052824881 9:33167348-33167370 GCCCGAGGCGCCGGCGGAGAGGG + Exonic
1057881465 9:98796060-98796082 GCCCGAGACGCGGTCCCCGGCGG - Intronic
1061565497 9:131436644-131436666 GCCGGAGTCGCTGCCGCAGCCGG + Exonic
1061725986 9:132582317-132582339 GCCCGGGCCGCGCTAGCAGCGGG - Exonic
1062042523 9:134410686-134410708 GCCCGAGGCGTGGCTGGAGCTGG + Intronic
1197782444 X:130171686-130171708 GGCCGAGGCGCGGCGGCGGCTGG + Exonic
1200292489 X:154886333-154886355 TCCCGACGCGCCGCCGCAGCTGG - Exonic
1200339333 X:155382073-155382095 TCCCGACGCGCCGCCGCAGCTGG - Intergenic
1200347137 X:155458620-155458642 TCCCGACGCGCCGCCGCAGCTGG + Exonic
1200787741 Y:7274411-7274433 CCCCGAGGCGCGGTCGCCGGAGG + Intergenic