ID: 910428784

View in Genome Browser
Species Human (GRCh38)
Location 1:87140970-87140992
Sequence ATCAGATGACTCAACTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910428783_910428784 2 Left 910428783 1:87140945-87140967 CCAACAGCAATGGTTCTGAATGC No data
Right 910428784 1:87140970-87140992 ATCAGATGACTCAACTGTACAGG 0: 1
1: 0
2: 0
3: 2
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910428784 Original CRISPR ATCAGATGACTCAACTGTAC AGG Intronic