ID: 910428784 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:87140970-87140992 |
Sequence | ATCAGATGACTCAACTGTAC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 82 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 79} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
910428783_910428784 | 2 | Left | 910428783 | 1:87140945-87140967 | CCAACAGCAATGGTTCTGAATGC | No data | ||
Right | 910428784 | 1:87140970-87140992 | ATCAGATGACTCAACTGTACAGG | 0: 1 1: 0 2: 0 3: 2 4: 79 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
910428784 | Original CRISPR | ATCAGATGACTCAACTGTAC AGG | Intronic | ||