ID: 910429021

View in Genome Browser
Species Human (GRCh38)
Location 1:87143031-87143053
Sequence CGCTGTGTGAGGAGGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 256}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910429021_910429034 25 Left 910429021 1:87143031-87143053 CCTGCCGCCCTCCTCACACAGCG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 910429034 1:87143079-87143101 CTGCTGGTGGCTCAGCAACTTGG No data
910429021_910429037 28 Left 910429021 1:87143031-87143053 CCTGCCGCCCTCCTCACACAGCG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 910429037 1:87143082-87143104 CTGGTGGCTCAGCAACTTGGGGG 0: 1
1: 0
2: 0
3: 27
4: 418
910429021_910429035 26 Left 910429021 1:87143031-87143053 CCTGCCGCCCTCCTCACACAGCG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 910429035 1:87143080-87143102 TGCTGGTGGCTCAGCAACTTGGG No data
910429021_910429028 9 Left 910429021 1:87143031-87143053 CCTGCCGCCCTCCTCACACAGCG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 910429028 1:87143063-87143085 GCTCCCCTGCTTCCAGCTGCTGG 0: 1
1: 1
2: 4
3: 35
4: 422
910429021_910429030 12 Left 910429021 1:87143031-87143053 CCTGCCGCCCTCCTCACACAGCG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 910429030 1:87143066-87143088 CCCCTGCTTCCAGCTGCTGGTGG 0: 1
1: 0
2: 7
3: 52
4: 528
910429021_910429036 27 Left 910429021 1:87143031-87143053 CCTGCCGCCCTCCTCACACAGCG 0: 1
1: 0
2: 1
3: 28
4: 256
Right 910429036 1:87143081-87143103 GCTGGTGGCTCAGCAACTTGGGG 0: 1
1: 0
2: 0
3: 13
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910429021 Original CRISPR CGCTGTGTGAGGAGGGCGGC AGG (reversed) Intronic
900206979 1:1435820-1435842 CGGTGAGTGCGGCGGGCGGCCGG + Exonic
900435983 1:2631542-2631564 GGCTGTGTGAGGAGCGGGGACGG + Intronic
900857886 1:5200584-5200606 GGATGAGTGAGGAGGGCAGCAGG - Intergenic
901421069 1:9151573-9151595 CGGTGGGTGGTGAGGGCGGCTGG - Intergenic
901848861 1:12002267-12002289 AGCCTGGTGAGGAGGGCGGCTGG + Intronic
903413947 1:23168707-23168729 CGCGGGGAGGGGAGGGCGGCGGG - Intronic
903656082 1:24949682-24949704 GGCTGGGTGAGGTGGGCTGCTGG - Intronic
903750484 1:25617718-25617740 CGCGGTGAGGGGAGGGCGTCCGG - Exonic
903833488 1:26188643-26188665 CGCTGTGTGGGGGTGGCTGCAGG - Exonic
904384079 1:30130289-30130311 AGCTGGCTGAGGAGGGAGGCTGG + Intergenic
904565217 1:31424690-31424712 GGGTGTGTGAGGAGGGGGCCGGG + Exonic
905434178 1:37945815-37945837 TGCTGTGTGAGGGGGACAGCCGG - Exonic
905626535 1:39493250-39493272 TGCTGTCTGTGGAGGGAGGCTGG - Intronic
906073503 1:43035096-43035118 CGAAGTGTGAGGATGGCAGCAGG + Intergenic
906726664 1:48049175-48049197 AGCTGTCTGAGGAGGGCAGGAGG + Intergenic
910312006 1:85834600-85834622 TGCTGTGGGCGGAGGGGGGCTGG - Intronic
910429021 1:87143031-87143053 CGCTGTGTGAGGAGGGCGGCAGG - Intronic
912375097 1:109203436-109203458 GGCTGGGTGAGGAGGGTGTCGGG + Intronic
914490878 1:148149460-148149482 CGCTGTGGGTGGAGGGCGCCGGG + Intronic
915560492 1:156684349-156684371 CGCTGAGTGAGGAAGTGGGCAGG - Intergenic
919858329 1:201720563-201720585 CGCAGTCTGAGGAAGGTGGCAGG + Intronic
920117037 1:203628588-203628610 CTCTGTGTGAGGAGTCTGGCAGG + Intronic
920283618 1:204862770-204862792 GGCAGTGTGAGGAGGGAGGCTGG + Intronic
921066955 1:211630304-211630326 GGCAGTGTGGGGAGGGCGCCTGG - Intergenic
921389656 1:214605758-214605780 CGCTGTGGGTGGAGGGCACCAGG - Intronic
922170467 1:223150332-223150354 AGCTGAGTGAGGAGGGAGGATGG - Intergenic
923202262 1:231724168-231724190 CTCTGTGTGGGGAAGGGGGCAGG + Intronic
924037568 1:239953050-239953072 CGGTGTGTGAGGAGGCCTGGGGG - Intergenic
924090156 1:240493212-240493234 CGGTGAGCGAGGAGGGCTGCCGG - Exonic
1063754291 10:8988669-8988691 AGCTCTATGAGGAGGGTGGCAGG + Intergenic
1065780333 10:29161019-29161041 GGCTGTGTGAGGATGGGAGCAGG + Intergenic
1068955666 10:62817346-62817368 GGGTGTGTGAAGAGGGCAGCGGG - Intronic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1071293470 10:84203223-84203245 CTCTGTGTGAGGAGGGCAACCGG - Intronic
1072263204 10:93702354-93702376 GGGTGTGTGAGGAGGGCTGTGGG - Exonic
1072636989 10:97184880-97184902 GGCTGGGTGTGGAGGGAGGCGGG + Intronic
1073960689 10:108924141-108924163 CGCTGTGTGGGTAAGGCTGCTGG - Intergenic
1074707452 10:116147617-116147639 CTCTGTGTGAGGATGGCAGGTGG - Intronic
1075223143 10:120601679-120601701 GGCTGTGTGTGGCGGGTGGCAGG + Intergenic
1075738963 10:124681843-124681865 CCCCGTGGGAGGAGGCCGGCTGG - Exonic
1076146463 10:128126212-128126234 CGGTGTGTGCGGAGCGTGGCGGG - Exonic
1076787790 10:132759699-132759721 TGCAGGGTGAGGAGGGCGCCGGG - Intronic
1076869610 10:133186933-133186955 GGCTGTGTGAGGAGCCGGGCAGG - Intronic
1077292430 11:1804137-1804159 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292448 11:1804187-1804209 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292454 11:1804203-1804225 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292472 11:1804253-1804275 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292478 11:1804269-1804291 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292484 11:1804285-1804307 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077870767 11:6259815-6259837 GGCAGGGAGAGGAGGGCGGCGGG + Exonic
1078852049 11:15172818-15172840 AGATGTGTGAGAAGGGAGGCTGG + Intronic
1081566873 11:44265667-44265689 GGTTGGGTGAGGTGGGCGGCAGG + Intronic
1081809769 11:45908264-45908286 AGCTGTCAGAGGAGAGCGGCTGG - Intergenic
1083509910 11:63199550-63199572 AGCTAAGTGAGGAGGGAGGCGGG - Intronic
1083757615 11:64800170-64800192 AGCTGTGTGAGGAGGGCCCGAGG + Exonic
1084383033 11:68825689-68825711 GGCTGGGTGAGGTGGGGGGCAGG - Intronic
1084522181 11:69670319-69670341 CGCTGTGGGAGAAGGGAGACAGG + Intronic
1085836616 11:79963386-79963408 AGCTGTGTGAGGATGGTGGTAGG - Intergenic
1089063651 11:115645955-115645977 CGCTGCGTGGGGAGTGCGGAGGG + Intergenic
1092246667 12:6867801-6867823 GGCTGTGGGACGAGGGCCGCTGG + Intronic
1093766876 12:22973729-22973751 CGCTGTGTGGGCAGGGGGCCTGG + Intergenic
1099972283 12:89512653-89512675 GGCTGAGGGAGGCGGGCGGCTGG + Intronic
1100329506 12:93570954-93570976 CGCTGACTGGGGAGGGAGGCGGG + Intronic
1100984999 12:100195291-100195313 CTCTGTGTGTGTAGGGGGGCTGG - Intergenic
1102931386 12:116865021-116865043 CACCGTGTGAGGGGGGAGGCGGG + Intronic
1103839410 12:123850448-123850470 CGCTGTGTGAGGTGGTGGGCTGG + Intronic
1103884750 12:124192039-124192061 CCCTGTATGAGAAGGGAGGCTGG - Intronic
1103978026 12:124716479-124716501 TGGTGTGTTAGCAGGGCGGCTGG + Intergenic
1104655160 12:130568925-130568947 GGCTGTGTGAGGAGGGCACGTGG - Intronic
1108273110 13:48782651-48782673 CGCTGTGTCAGGAGTGTGACTGG - Intergenic
1108459486 13:50650959-50650981 CTCCCTGTGAGGAGGGCAGCAGG + Intronic
1113655107 13:112063085-112063107 CGCAGCGAGAGGAGGGCGGGCGG - Intergenic
1113748438 13:112762230-112762252 CGCTGTGATAGGAGGCCAGCAGG - Intronic
1115474357 14:33799713-33799735 CTCTGTGTGGGGCGGGGGGCCGG - Exonic
1119653359 14:76399148-76399170 GGCTGTGTGATGAGGGAGACGGG + Intronic
1120861169 14:89256129-89256151 GGCAGTGTGAGGAGGGTGGCAGG - Intronic
1122079599 14:99257585-99257607 CGGAGCGTGAGGAGGGTGGCGGG + Exonic
1122149244 14:99715930-99715952 ATCTGTGTGAGGATGTCGGCAGG - Exonic
1122786399 14:104166160-104166182 CCCTGAGTGACGAGGGTGGCAGG + Intronic
1122951554 14:105047809-105047831 GGCTGTGGGCGGAGGGCAGCAGG - Intergenic
1122967385 14:105137742-105137764 CGTTCTGAGAGGAGGGCAGCCGG - Intergenic
1123471987 15:20562450-20562472 CGCAGGGTGGGGAGGGAGGCGGG - Intergenic
1123646016 15:22437903-22437925 CGCAGGGTGGGGAGGGAGGCGGG + Intergenic
1123667321 15:22617757-22617779 CGCAGGGTGGGGAGGGAGGCAGG + Intergenic
1123739818 15:23225954-23225976 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1123750426 15:23354823-23354845 CGCAGGGTGGGGAGGGAGGCGGG - Intronic
1124282796 15:28378739-28378761 CGCAGGGTGGGGAGGGAGGCGGG - Exonic
1124291043 15:28454927-28454949 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1124299903 15:28532874-28532896 CGCAGGGTGGGGAGGGAGGCGGG + Exonic
1124321163 15:28712324-28712346 CGCAGGGTGGGGAGGGAGGCAGG + Intronic
1124481334 15:30083030-30083052 CGCAGGGTGGGGAGGGAGGCAGG - Intergenic
1124487789 15:30135126-30135148 CGCAGGGTGGGGAGGGAGGCAGG - Intergenic
1124542880 15:30604103-30604125 CGCAGGGTGGGGAGGGAGGCAGG - Intergenic
1124563286 15:30794409-30794431 CACTGTGTGAGGAGGATGGAGGG - Intergenic
1124755739 15:32403195-32403217 CGCAGGGTGGGGAGGGAGGCAGG + Exonic
1127488173 15:59438190-59438212 CGCTGGCTGAGCAGGGCGCCCGG - Exonic
1128639279 15:69324209-69324231 CCCTGTGTGAGGATGGCAGGGGG - Intronic
1130046879 15:80452656-80452678 GGCTCTGTGAGGAGGGAGGTGGG + Intronic
1130260385 15:82349340-82349362 CGCGGGGTGGGGAGGGAGGCGGG + Exonic
1130268344 15:82430093-82430115 CGCGGGGTGGGGAGGGAGGCGGG - Exonic
1130280847 15:82519667-82519689 CGCGGGGTGGGGAGGGAGGCGGG - Intergenic
1130479711 15:84350419-84350441 CGCGGGGTGGGGAGGGAGGCGGG - Intergenic
1130492059 15:84437710-84437732 CGCGGGGTGGGGAGGGAGGCGGG + Intergenic
1130503676 15:84516750-84516772 CGCGGGGTGGGGAGGGAGGCGGG + Intergenic
1130594516 15:85240485-85240507 CGCGGGGTGGGGAGGGAGGCGGG - Intergenic
1132433591 15:101779299-101779321 CGCTGTGGGAGGAGGTTGGAGGG + Intergenic
1132571866 16:647762-647784 GGCTGTGGGAGGAGGGCAGTCGG - Exonic
1132785916 16:1656918-1656940 CGCTGCTTGTGGAGGGCGGTGGG - Exonic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1133283327 16:4679323-4679345 TGCTGAGTGAGCTGGGCGGCCGG + Intronic
1134191562 16:12125299-12125321 AGCTGTGTGGGGAAGGCGGAAGG + Intronic
1136264984 16:29110848-29110870 TGCTGTGTGATGGGGGCAGCTGG - Intergenic
1136265195 16:29112506-29112528 TGCTGTGTGATGGGGGCAGCTGG + Intergenic
1136344369 16:29665410-29665432 TGCTGGGTGAGGATGGCAGCAGG - Exonic
1136707719 16:32202716-32202738 CGCTGTGGGTGGAGGGCGCCGGG + Intergenic
1136760190 16:32726694-32726716 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1136807914 16:33143692-33143714 CGCTGTGGGTGGAGGGCGCCGGG + Intergenic
1137758360 16:50920279-50920301 GGCTGTGTGAAGAGGGCAGCTGG + Intergenic
1138187090 16:54985110-54985132 TGCTGGGTGAGGAGGGCTCCTGG - Intergenic
1138346424 16:56323027-56323049 CGCTGTGGGAGCAGGGAGGTGGG + Intronic
1139936085 16:70572186-70572208 CTCTGTGGGAGGAAGGAGGCAGG + Exonic
1140543487 16:75783170-75783192 GGCTGTGGGAGGAGGGTGGATGG - Intergenic
1141234340 16:82201419-82201441 TGATGTGTGAGGAGGTCAGCTGG + Intergenic
1141591610 16:85073051-85073073 GGCTGGGTGGGGAGGGAGGCAGG - Intronic
1141593974 16:85086453-85086475 CGCGGTGTGAGGATCCCGGCAGG + Intronic
1142053777 16:87978823-87978845 TGCTGTGTGATGGGGGCAGCTGG - Intronic
1142053994 16:87980481-87980503 TGCTGTGTGATGGGGGCAGCTGG + Intronic
1142406361 16:89892372-89892394 TGCTGGGGGTGGAGGGCGGCGGG + Intronic
1203062345 16_KI270728v1_random:987016-987038 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1142637048 17:1264255-1264277 GGCGGTGTGGGGAGGGCGGGTGG - Intergenic
1143653123 17:8276636-8276658 CACTCTGAGAGGAGGGAGGCAGG + Intergenic
1144473287 17:15563272-15563294 AGTTGTCTGAGGAGGGCTGCTGG - Intronic
1144923195 17:18781448-18781470 AGTTGTCTGAGGAGGGCTGCTGG + Intronic
1145191499 17:20844155-20844177 CGCTGTGGGTGGAGGGCGCCGGG + Intronic
1145281997 17:21475019-21475041 CGCTGTATGAGGAGGGGAGGAGG - Intergenic
1147054579 17:37824555-37824577 TGCTGTGTCAGCAGGGCTGCAGG - Intergenic
1148491021 17:48024095-48024117 CGCTGGGGGTGGAGGGCCGCCGG - Intergenic
1149916426 17:60613902-60613924 GGCTGTGTGAGGCGGGGGGGTGG - Intronic
1150643546 17:66964843-66964865 CGCGGAGGGAGGAGGGCGGGCGG + Intergenic
1151296805 17:73192332-73192354 CCATGGGGGAGGAGGGCGGCGGG - Intergenic
1151758444 17:76087762-76087784 CGCTGTGGGAGGCCGTCGGCCGG - Intronic
1151822490 17:76504257-76504279 GGCTGTGTGAGGAGGAGGACAGG + Intergenic
1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG + Intronic
1153747055 18:8190268-8190290 GGCTGTGTGGGGAGGGAGGCTGG - Intronic
1153952513 18:10069181-10069203 CGCTGTGAGAGGCGGGGAGCTGG - Intergenic
1156350733 18:36298642-36298664 CGCTGTGGGAGGAGGGGCGGGGG + Intronic
1160359074 18:78255465-78255487 GGGGGTGTGAGGAGGGCGTCAGG - Intergenic
1160527114 18:79544510-79544532 CTCTGTGTGTGGAGGGTGGGCGG + Intergenic
1160553366 18:79710445-79710467 GTCTTTGTGAGGAGCGCGGCTGG - Intronic
1160867505 19:1262377-1262399 TGCTGGGAGAGGAGGGCGGGTGG - Intronic
1160994708 19:1877284-1877306 CGCTGTGGGTGGAGGGCGCCGGG - Exonic
1161220633 19:3116508-3116530 CGCTGCATGAGGATGGGGGCAGG - Intronic
1161234475 19:3191001-3191023 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161234487 19:3191063-3191085 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161426761 19:4207946-4207968 CGCTGGGTGGGGAGGGGCGCTGG - Exonic
1162111848 19:8403795-8403817 GGCGGGGTGGGGAGGGCGGCAGG + Exonic
1162139544 19:8577505-8577527 AGCTGGGTGTGGAGGGGGGCGGG + Exonic
1162766780 19:12924622-12924644 AGCTGGGTGAGCAGGGGGGCAGG - Exonic
1162931979 19:13962060-13962082 CCGGCTGTGAGGAGGGCGGCAGG - Exonic
1163536872 19:17881939-17881961 TGCTGTGTGAGGAAGGCAGCGGG - Exonic
1163580362 19:18135117-18135139 TGCTGAGTGAGGCGGGTGGCTGG + Intronic
1163685368 19:18709248-18709270 CCCTGTGTGAGGGAGGCTGCGGG - Intronic
1165155305 19:33783394-33783416 AGCTGTGTGAGCAGGGAGCCTGG + Intergenic
1165490805 19:36121661-36121683 CGCTGTGAGGTGCGGGCGGCGGG + Exonic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
1168717896 19:58539802-58539824 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717908 19:58539842-58539864 CTCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718045 19:58540422-58540444 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718288 19:58541390-58541412 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718397 19:58541853-58541875 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718489 19:58542240-58542262 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718539 19:58542436-58542458 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718619 19:58542784-58542806 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
926698212 2:15785238-15785260 CCCTGTGTGCCGAGGGCAGCGGG + Intergenic
927970988 2:27306379-27306401 CTCTGTGTGGGGGGTGCGGCGGG + Intronic
930583919 2:53247568-53247590 TGCTGTGTGAGGTGGGGGGTTGG + Intergenic
931216219 2:60247469-60247491 GGCTGTCCCAGGAGGGCGGCTGG - Intergenic
933778079 2:85783851-85783873 GGCTGTGTGTGGGGGGCGGGGGG - Intronic
934708481 2:96500737-96500759 TGCTGCGGGAGGAGAGCGGCTGG - Exonic
935645303 2:105329604-105329626 CGGTGAGTGAGGAGGGCGGCGGG - Exonic
935693366 2:105749719-105749741 CGGTGTGAGGGGAGGCCGGCAGG + Intronic
937304665 2:120863985-120864007 ACTTGTGTGTGGAGGGCGGCTGG + Intronic
938128895 2:128694007-128694029 AGGTGTGTGAGCCGGGCGGCAGG - Intergenic
946067701 2:217003392-217003414 CACTTTGTAAGGAGGGTGGCTGG - Intergenic
946382432 2:219358334-219358356 CGCTGTGTGGGCAGGGTGCCTGG - Intergenic
947500047 2:230665049-230665071 GGCTGTGTGATGAGGGTGGTTGG - Intergenic
948189412 2:236046329-236046351 TGCTGTGTGAAGAGGTCTGCAGG + Intronic
948560581 2:238848764-238848786 CGCTGCGGGGGGCGGGCGGCAGG + Intronic
1168968016 20:1911764-1911786 CTCAGGGAGAGGAGGGCGGCTGG - Intronic
1170578127 20:17680220-17680242 AGGAGTGTGAGGAGGGAGGCGGG + Intronic
1173766240 20:45612274-45612296 CTCTGTGTGTGGAGGGAGACAGG + Intronic
1174306465 20:49617398-49617420 TGCAGGGTGAGGAGGGTGGCGGG - Intergenic
1175227706 20:57454461-57454483 GGCTGTGTGAAGACGGTGGCAGG - Intergenic
1176143234 20:63554144-63554166 CGCGGAGTGCGGAGGGAGGCTGG + Exonic
1176186978 20:63785775-63785797 AGCTGTGTGAGGATGGAGGATGG - Intronic
1179802496 21:43817481-43817503 CTATGTGGGAGGAGGGCGCCAGG - Intergenic
1180109706 21:45642397-45642419 AGCTGGGTGTGGGGGGCGGCAGG - Intergenic
1180569251 22:16700376-16700398 CGGTGTGTGAGGTGGCTGGCTGG - Intergenic
1181120796 22:20667902-20667924 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1181333758 22:22114928-22114950 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1184606341 22:45576811-45576833 CCCTGTGTGGGGAGGGTGGAGGG - Intronic
1184863570 22:47190506-47190528 CGCTGGGTGGGGAGGGCTCCTGG - Intergenic
1185095410 22:48803625-48803647 GGCTGTTTGAGGAGGGCAGCTGG + Intronic
1185420380 22:50731487-50731509 CGCTGGGTGGGCTGGGCGGCCGG - Intergenic
950567947 3:13782359-13782381 CTCTGTGTGGGGAGGGAGGTCGG - Intergenic
954105654 3:48408569-48408591 GGATGTGTGAGGAGGGGAGCTGG - Intronic
954761161 3:52875450-52875472 CACTGTGTGAGGGGGCCAGCAGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956782982 3:72619026-72619048 CGGTTTCTGAGGAGGGCAGCTGG + Intergenic
958632559 3:96701619-96701641 CGCTGGGTGGGGAGGGGGGCGGG - Intergenic
960637878 3:119801821-119801843 TGCTGTTTGGTGAGGGCGGCCGG + Intronic
961532282 3:127547127-127547149 CGCGGTGTCAGCTGGGCGGCAGG + Intergenic
967070769 3:185960742-185960764 CGGAGTGAGAGGAGGGTGGCAGG - Intergenic
967282304 3:187834042-187834064 CCCTGTGTGAAGAAGGTGGCTGG + Intergenic
968616431 4:1579559-1579581 CTCTGTGTGACCAGGGCGGATGG + Intergenic
969524898 4:7699406-7699428 CGCTTGGAGAGGAGGGTGGCTGG + Intronic
975661117 4:76689701-76689723 TGGTGAGTGAGGAGGGCGGCTGG + Intronic
975800716 4:78057260-78057282 GCCTGGGTGAGGAGGGCTGCGGG - Intergenic
985250891 4:188023367-188023389 AGCTGGGTGAGGAGGGGGGATGG + Intergenic
985607026 5:863321-863343 CGCTGGGTGAGCAGGGTGGCCGG - Intronic
985732148 5:1555325-1555347 TCGTGTGTGAGGAGGGCGCCCGG - Intergenic
992896777 5:81252674-81252696 CGCTGTGTGGGGAGGAGGGCAGG - Exonic
994186379 5:96819443-96819465 TGCTGTGAGAGGAGGAAGGCAGG + Intronic
994639561 5:102389977-102389999 GGCTGAGTGAGGAGGGAGGATGG - Intronic
997233144 5:132257994-132258016 CAGCGTGGGAGGAGGGCGGCTGG - Intronic
997527147 5:134560727-134560749 CTCTCTGTGAGGAGGACAGCAGG - Exonic
1000393525 5:160749425-160749447 CACAGTATGAGGAGGGCAGCTGG - Intronic
1002135865 5:177107206-177107228 TGCTGTGTGACGTGGGCAGCAGG - Intergenic
1002561118 5:180083047-180083069 TGCTGTGGGAGGGGGGCGGGTGG - Intergenic
1003150978 6:3548738-3548760 CGCTCTGTGAGGAGGTTGGGAGG + Intergenic
1004615185 6:17281952-17281974 CGCTGTGCGAGGTCGGGGGCCGG + Intronic
1005935309 6:30516624-30516646 CGCTGTGGGCGGAGGCGGGCAGG - Intergenic
1006420497 6:33930986-33931008 GCCGGTGTGAGGAGGGCAGCAGG + Intergenic
1007576638 6:42929419-42929441 GGCTGCGAGAGGAGGGCGGGCGG + Exonic
1007767083 6:44166931-44166953 TGTTGTGTGGGGAGGGCGGCGGG + Intronic
1011798608 6:90983817-90983839 GGCTGTGTGAAGAGGGAGGCAGG - Intergenic
1012237899 6:96838606-96838628 CTCTGTCTGAGGAGGTGGGCAGG + Intergenic
1017206626 6:151809208-151809230 CACTGTGGAAGGAGCGCGGCCGG + Intronic
1018849083 6:167574909-167574931 CCCTGGCTGTGGAGGGCGGCGGG - Intergenic
1018928646 6:168224468-168224490 CGAGGTCTGAGGAGGGCGGCTGG + Intergenic
1019350044 7:550329-550351 CGCTGTGTGAGGTGTGGGCCGGG - Exonic
1019478201 7:1254311-1254333 CGGTGGGTGGGGAGGGCCGCTGG - Intergenic
1019576788 7:1741441-1741463 GCCTGTGTGATGAGGGAGGCAGG - Intronic
1019646894 7:2135653-2135675 CGCTGTGAGAGCTGGGGGGCAGG - Intronic
1019700153 7:2470892-2470914 CGCTTTGTGCTGAGGGCGGTGGG + Intergenic
1020239950 7:6386256-6386278 TGCTGTGTGAGGATTGGGGCTGG + Intronic
1025027211 7:55526438-55526460 CGCTGAGTGAGGAAGGACGCAGG + Intronic
1025801322 7:64789218-64789240 AGGTGTGGGAGGAGGGCAGCAGG - Intergenic
1027233480 7:76284841-76284863 AGCTGAGTGAGGAGTGGGGCCGG + Intronic
1029270183 7:99372943-99372965 CCCTGTGGGAAGAGGGCTGCCGG + Intronic
1029371946 7:100155797-100155819 AGCTGTGTGAGGAGGAGCGCCGG - Exonic
1029464472 7:100716637-100716659 AGCTGTGTGAGGGGAGGGGCAGG + Intergenic
1029485939 7:100840500-100840522 CGCTGTGTGTTGGGGGCGGGGGG - Intronic
1030496569 7:110308018-110308040 GAGTGTGTGAGGAGGGAGGCTGG + Intergenic
1034115285 7:148578638-148578660 GGCTGGCTGAGGACGGCGGCTGG + Intergenic
1036397987 8:8385292-8385314 CTCTGCGTGAGTAGGGAGGCAGG - Intronic
1036700352 8:11009079-11009101 AGCTGTGTGGGGAGGGGGGTGGG + Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1048209678 8:132444268-132444290 GGCTGGGTGAGGAGGGCAGGAGG - Intronic
1048657860 8:136562168-136562190 CGTGGTGTGAGGAGGGGGGAGGG + Intergenic
1048860302 8:138719894-138719916 CCCTGTGGGTGGAGGGCGGGAGG + Intronic
1049537852 8:143190219-143190241 CGCTGTAAGAGGAGGGAGGCGGG - Intergenic
1049707405 8:144049259-144049281 GGGTGGCTGAGGAGGGCGGCGGG + Intergenic
1049735623 8:144203068-144203090 CGCTGTCTGTGGAGGGGGGGCGG + Intronic
1049748530 8:144273053-144273075 CGCTGCTTGTGGAGGGCGCCCGG - Intronic
1051936230 9:22446690-22446712 CCTTCTGGGAGGAGGGCGGCGGG - Intergenic
1053004115 9:34593150-34593172 CACTGTGTGAGGAAGCAGGCGGG - Intergenic
1053416072 9:37947568-37947590 TGCAGAGTCAGGAGGGCGGCAGG - Intronic
1056532212 9:87497871-87497893 CGGAGTGTGAGGAGGACAGCCGG + Exonic
1057303439 9:93899474-93899496 CTCTGTATGAGGAGGGGAGCTGG - Intergenic
1060792948 9:126498076-126498098 CGCTGCGGGAGGAGAGAGGCAGG - Intronic
1061064225 9:128267393-128267415 CGCTGTGGGAGGAGGTTGGAGGG + Intronic
1061202214 9:129144383-129144405 CGCTGTGTGGGGAAGGGGACAGG + Intronic
1062470092 9:136698858-136698880 CGCTGCGTGCGGAAGGCCGCAGG + Intergenic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1062625044 9:137438748-137438770 CCCTGTGGGAGGGGGGCGGGGGG + Intronic
1186137079 X:6532941-6532963 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137098 X:6533000-6533022 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137210 X:6533314-6533336 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186747205 X:12582513-12582535 CCCTGTGGGAGGAGGGAGGCAGG + Intronic
1186800543 X:13088200-13088222 CGGAGTGTGAGGAGGGTGTCTGG - Intergenic
1188483077 X:30653726-30653748 CGCTGGGCAAGGAGGGAGGCCGG + Intronic
1190264291 X:48818131-48818153 CGCAGTGTGATCAGGGAGGCGGG + Intronic
1196186177 X:112747409-112747431 CTCACTGTGAGGAGGGCGACTGG - Intergenic
1200000387 X:153056845-153056867 CGCCCGGGGAGGAGGGCGGCTGG + Intronic
1200053567 X:153447005-153447027 CACTGTGAGAGGTGGGAGGCCGG - Intronic